Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU037901

Sigma-Aldrich

MISSION® esiRNA

targeting human USP1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AAGACCCTGAGATGGGCAATTTCACAATTTGCTTCAGTAGAAAGGATTGTAGGAGAAGATAAATATTTCTGTGAAAACTGCCATCATTATACTGAAGCTGAACGAAGTCTTTTGTTTGACAAAATGCCTGAAGTTATAACTATTCATTTGAAGTGCTTTGCTGCTAGTGGTTTGGAGTTTGATTGTTATGGTGGTGGACTTTCCAAGATCAACACTCCTTTATTGACACCTCTTAAATTGTCACTAGAAGAATGGAGCACAAAGCCAACTAACGACAGCTATGGATTATTTGCGGTTGTGATGCATAGTGGCATTACAATTAGTAGTGGGCATTACACTGCTTCTGTTAAAGTCACTGACCTTAACAGTTTAGAACTAGATAAAGGAAATTTTGTGGTTGACCAAATGTGTGAAATAGGTAAGCCAGAACCATTGAATGAGGAGGAAGCAAGGGGTGTGGTTGAGAAT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

M Raimondi et al.
Cell cycle (Georgetown, Tex.), 15(1), 106-116 (2016-01-16)
CAPNS1 is essential for the stability and function of ubiquitous CAPN1 and CAPN2. Calpain modulates by proteolytic cleavage many cellular substrates and its activity is often deregulated in cancer cells, therefore calpain inhibition has been proposed as a therapeutical strategy
Maura Sonego et al.
Science advances, 5(5), eaav3235-eaav3235 (2019-05-16)
Resistance to platinum-based chemotherapy is a common event in patients with cancer, generally associated with tumor dissemination and metastasis. Whether platinum treatment per se activates molecular pathways linked to tumor spreading is not known. Here, we report that the ubiquitin-specific
Dana Goldbraikh et al.
EMBO reports, 21(4), e48791-e48791 (2020-03-07)
PI3K-Akt-FoxO-mTOR signaling is the central pathway controlling growth and metabolism in all cells. Ubiquitination of the protein kinase Akt prior to its phosphorylation is required for PI3K-Akt activity. Here, we found that the deubiquitinating (DUB) enzyme USP1 removes K63-linked polyubiquitin

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique