Accéder au contenu
Merck
Toutes les photos(1)

Documents

EHU037471

Sigma-Aldrich

MISSION® esiRNA

targeting human ECT2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTTGGATTCTCCGGAATTTGAAAATGTATTTGTAGTCACGGACTTTCAGGATTCTGTCTTTAATGACCTCTACAAGGCTGATTGTAGAGTTATTGGACCACCAGTTGTATTAAATTGTTCACAAAAAGGAGAGCCTTTGCCATTTTCATGTCGCCCGTTGTATTGTACAAGTATGATGAATCTAGTACTATGCTTTACTGGATTTAGGAAAAAAGAAGAACTAGTCAGGTTGGTGACATTGGTCCATCACATGGGTGGAGTTATTCGAAAAGACTTTAATTCAAAAGTTACACATTTGGTGGCAAATTGTACACAAGGAGAAAAATTCAGGGTTGCTGTGAGTCTAGGTACTCCAATTATGAAGCCAGAATGGATTTATAAAGCTTGGGAAAGGCGGAATGAACAGGAT

Numéro d'accès Ensembl | humain

ENSG00000114346

Numéro d'accès NCBI

NM_018098

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... ECT2(1894) , ECT2(1894)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Zheng-Qing Fang et al.
Journal of cellular biochemistry, 119(10), 8317-8324 (2018-06-23)
We intended to evaluate miR-490-5p expression in hepatocellular carcinoma (HCC) tissues and detect the potential targets of miR-490-5p. In vitro experiments were conducted to further investigate the biological function of miR-490-5p on HCC cell metastasis. We investigated the abnormally expressed
Zeinab Kosibaty et al.
Laboratory investigation; a journal of technical methods and pathology, 99(4), 551-567 (2018-12-14)
Epithelial cell transforming sequence 2 (ECT2), a guanine nucleotide exchange factor, is predominantly localized in the nucleus of non-transformed cells and functions to regulate cytokinesis. ECT2 is also localized in the cytoplasm of cancer cells. Aberrant cytoplasmic expression of ECT2
J Sebastián Gómez-Cavazos et al.
Current biology : CB, 30(16), 3101-3115 (2020-07-04)
Cytokinesis partitions the cell contents to complete mitosis. During cytokinesis, polo-like kinase 1 (PLK1) activates the small GTPase RhoA to assemble a contractile actomyosin ring. PLK1 is proposed to pattern RhoA activation by creating a docking site on the central

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique