Accéder au contenu
Merck
Toutes les photos(2)

Documents

EHU032581

Sigma-Aldrich

MISSION® esiRNA

targeting human CAPN1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(2)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GACATGGAGATCAGCGTGAAGGAGTTGCGGACAATCCTCAATAGGATCATCAGCAAACACAAAGACCTGCGGACCAAGGGCTTCAGCCTAGAGTCGTGCCGCAGCATGGTGAACCTCATGGATCGTGATGGCAATGGGAAGCTGGGCCTGGTGGAGTTCAACATCCTGTGGAACCGCATCCGGAATTACCTGTCCATCTTCCGGAAGTTTGACCTGGACAAGTCGGGCAGCATGAGTGCCTACGAGATGCGGATGGCCATTGAGTCGGCAGGCTTCAAGCTCAACAAGAAGCTGTACGAGCTCATCATCACCCGCTACTCGGAGCCCGACCTGGCGGTCGACTTTGACAATTTCGTTTGCTGCCTGGTGCGGCTAGAGACCATGTTCCGATTTTTCAAAACTCTGGACACAGATCTGGATGGAGTTGTGACCTTTGACTTGTTTAAGTGGTTGCAGCTGACCATGTTTGCATGAGG

Numéro d'accès Ensembl | humain

ENSG00000014216

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CAPN1(823) , CAPN1(823)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

L M Yu et al.
Clinical & translational oncology : official publication of the Federation of Spanish Oncology Societies and of the National Cancer Institute of Mexico, 21(7), 924-932 (2018-12-20)
Pancreatic cancer (PC) is a highly aggressive and metastatic disease, with an elevated mortality rate. It is, therefore, crucial to assess factors affecting the prognosis of PC patients. Meanwhile, calpain-1 is associated with malignant tumor progression and metastasis. Thus, it
Meei-Ling Sheu et al.
Oncotarget, 8(12), 19376-19388 (2016-12-31)
Ochratoxin A (OTA) contaminated food increases reactive oxygen species (ROS) production in glomerulus and causes glomerulopathy. The molecular mechanisms still remain uncertain. In this study, we used mouse and rat glomerular mesangial cells and delineate the signaling pathway behind the
Mathieu Chocry et al.
Oncotarget, 8(61), 103710-103730 (2017-12-22)
Oxaliplatin is a major treatment for metastatic colorectal cancer, however its effectiveness is greatly diminished by the development of resistances. Our previous work has shown that oxaliplatin efficacy depends on the reactive oxygen species (ROS) produced by Nox1. In this

Articles

esiRNA Knockdown Efficiency Tested by Western Blotting

Quantitative and qualitative western blotting to validate knockdown by esiRNA. Sigma-Aldrich.com

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique