Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU029771

Sigma-Aldrich

MISSION® esiRNA

targeting human MYD88

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TGCAGAGCAAGGAATGTGACTTCCAGACCAAATTTGCACTCAGCCTCTCTCCAGGTGCCCATCAGAAGCGACTGATCCCCATCAAGTACAAGGCAATGAAGAAAGAGTTCCCCAGCATCCTGAGGTTCATCACTGTCTGCGACTACACCAACCCCTGCACCAAATCTTGGTTCTGGACTCGCCTTGCCAAGGCCTTGTCCCTGCCCTGAAGACTGTTCTGAGGCCCTGGGTGTGTGTGTATCTGTCTGCCTGTCCATGTACTTCTGCCCTGCCTCCTCCTTTCGTTGTAGGAGGAATCTGTGCTCTACTTACCTCTCAATTCCTGGAGATGCCAACTTCACAGACACGTCTGCAGCAGCTGGACATCACATTTCATGTCCTGCATGGAACCAGTGGCTGTGAGTGGCATGTCCACTTGCTGGATTATCAGCCAGGACACTATAGAACAGGACCAGCTGAGACTAAGAAGGACCAGCAGAGCC

Numéro d'accès Ensembl | humain

ENSG00000172936

Numéro d'accès NCBI

NM_002468

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... MYD88(4615) , MYD88(4615)

Catégories apparentées

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Michele Cea et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 22(24), 6099-6109 (2016-06-12)
Nicotinamide phosphoribosyltransferase (Nampt) regulates intracellular NAD We investigated Nampt role in MW cells using both mRNA and protein expression analyses. We have also used loss-of-function approaches to investigate the growth and survival effects of Nampt on MW cells and further
Lingyu Zhang et al.
Gene, 700, 85-95 (2019-03-18)
MiR-155-3p, which is derived from the same pre-miRNA as miR-155-5p, the latter has been reported to be dysregulated in multiple tumor tissues and associated with clinicopathologic markers, tumor subtypes, and poor survival rates. However, the biological effects of miR-155-3p are
Xin Wen et al.
Journal of cellular physiology, 233(9), 7022-7034 (2018-01-31)
Epilepsy is a group of neurological disorders characterized by epileptic seizures. In this study, we aim to explore the role of microRNA-421 (miR-421) in hippocampal neurons of epilepsy mice via the TLR/MYD88 pathway. Forty mice were randomly served as the

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique