Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU029551

Sigma-Aldrich

MISSION® esiRNA

targeting human PIWIL4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAGCTGCCATCAAGTTCTCCCGTGTGCATCCAGGTCTTCAATATCATCTTCAGAAAGATCCTCAAAAAGTTGTCCATGTACCAAATTGGACGGAACTTCTATAATCCTTCAGAGCCAATGGAAATTCCCCAGCACAAATTATCCCTTTGGCCTGGGTTTGCCATTTCTGTGTCATATTTTGAAAGGAAGCTCCTGTTTAGTGCTGATGTGAGTTACAAAGTCCTCCGGAATGAGACGGTTCTGGAATTCATGACTGCTCTCTGTCAAAGAACTGGCTTGTCCTGTTTCACCCAGACGTGTGAGAAGCAGCTAATAGGGCTCATTGTCCTTACAAGATACAATAACAGAACCTACTCCATTGATGACATTGACTGGTCAGTGAAGCCCACACACACCTTTCAGAAGCGGGATGGCACCGAGATCACCTATGTGGATTACTACAAGCAGCAGTATGATATTACTGTATCGGACCTGAATCAGCC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Zealyn Shi Lin Heng et al.
Oncology reports, 40(5), 2525-2535 (2018-09-19)
A majority of breast cancer cases are positive for the estrogen receptor (ER), which means that they can respond to the estrogen hormone to achieve growth. Hence, the ER signaling pathway has been extensively targeted in pharmaceutical research and development
Charannya Sozheesvari Subhramanyam et al.
RNA biology, 17(11), 1613-1624 (2020-05-07)
PIWI homologs constitute a subclass of the Argonaute family. Traditionally, they have been shown to associate with a specific class of small RNAs, piRNAs, to suppress transposable elements and protect genomic integrity in germ cells. Recent studies imply that PIWI

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique