Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU020301

Sigma-Aldrich

MISSION® esiRNA

targeting human HDAC11

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GAGCTCAAGTGGTCCTTTGCTGTTGCTACCATCACAGAAATCCCCCCCGTTATCTTCCTCCCCAACTTCCTTGTGCAGAGGAAGGTGCTGAGGCCCCTTCGGACCCAGACAGGAGGAACCATAATGGCGGGGAAGCTGGCTGTGGAGCGAGGCTGGGCCATCAACGTGGGGGGTGGCTTCCACCACTGCTCCAGCGACCGTGGCGGGGGCTTCTGTGCCTATGCGGACATCACGCTCGCCATCAAGTTTCTGTTTGAGCGTGTGGAGGGCATCTCCAGGGCTACCATCATTGATCTTGATGCCCATCAGGGCAATGGGCATGAGCGAGACTTCATGGACGACAAGCGTGTGTACATCATGGATGTCTACAACCGCCACATCTACCCAGGGGACCGCTTTGCCAAGCAGGCCATCAGGCGGAAGGTGGAGCTGGAGTGGGGCACAGAGGATGATGAGTACCTGGATAAGGTGGAGAGGAACATCAAGAAATCCCTCCAGG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Li Yuan et al.
Journal of molecular and cellular cardiology, 122, 1-10 (2018-08-01)
Immune deregulation is a causative factor in pathogenesis of myocarditis. Histone deacetylases (HDAC) involve multiple biochemical activities in the cell. This study aims to elucidate the role of HDAC11 in the regulation of interleukin (IL)-13-expression in CD4+ T cells of
Ming-Yang Li et al.
Oncotarget, 7(48), 79914-79924 (2016-11-09)
The regulatory B cells (Breg) are important in the body immunity. The differentiation process of Breg is not fully understood yet. Ubiquitin A20 has immune regulatory functions. This study aims to investigate the role of A20 in the regulation of
Shashi Bala et al.
Journal of leukocyte biology, 102(2), 487-498 (2017-06-07)
Inflammation promotes the progression of alcoholic liver disease. Alcohol sensitizes KCs to gut-derived endotoxin (LPS); however, signaling pathways that perpetuate inflammation in alcoholic liver disease are only partially understood. We found that chronic alcohol feeding in mice induced miR-155, an

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique