Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

View All Documentation

EHU017331

Sigma-Aldrich

MISSION® esiRNA

targeting human TIMP2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

AAGCGGTCAGTGAGAAGGAAGTGGACTCTGGAAACGACATTTATGGCAACCCTATCAAGAGGATCCAGTATGAGATCAAGCAGATAAAGATGTTCAAAGGGCCTGAGAAGGATATAGAGTTTATCTACACGGCCCCCTCCTCGGCAGTGTGTGGGGTCTCGCTGGACGTTGGAGGAAAGAAGGAATATCTCATTGCAGGAAAGGCCGAGGGGGACGGCAAGATGCACATCACCCTCTGTGACTTCATCGTGCCCTGGGACACCCTGAGCACCACCCAGAAGAAGAGCCTGAACCACAGGTACCAGATGGGCTGCGAGTGCAAGATCACGCGCTGCCCCATGATCCCGTGCTACATCTCCTCCCCGGACGAGTGCCTCTGGATGGACTGGGTCACAGAGAAGAACATCAACGGGCACCAGGCCAAGTTCTTCGCCTGCATCAAGAGAAGTGACGGCTCCTGTGCGTGGTACCGCGGCGCGGCGCCCCCCAAGCAGGAGTTTCTCGAC

Numéro d'accès Ensembl | humain

ENSG00000035862

Numéro d'accès NCBI

NM_003255

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... TIMP2(7077) , TIMP2(7077)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Ji-Xiang Cao
Oncology reports, 41(6), 3367-3376 (2019-04-20)
Aberrantly expressed miRNAs play a crucial role in the progression of lung adenocarcinoma. However, to date, the role of miR‑888 in lung adenocarcinoma progression is unclear. In the present study, the biological function of miR‑888 and its underlying mechanism in
Guijun Zhang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 118, 109309-109309 (2019-09-24)
To explore the roles of long noncoding RNA (lncRNA) FOXF1 Adjacent Non-Coding Developmental Regulatory RNA (FENDRR) in human non-small cell lung cancer (NSCLC). The levels of FENDRR in NSCLC cells and tissues were analyzed using qRT-PCR assay. The growth and
Shanlan Yin et al.
Experimental and therapeutic medicine, 17(4), 2837-2846 (2019-03-25)
Human papillomaviruses (HPVs) have important roles in the development and progression of cervical cancer, but the underlying mechanisms are yet to be fully elucidated. MicroRNA-130a (miR-130a) has previously been reported to promote cervical cancer growth. However, the underlying molecular mechanisms
Hao Guan et al.
PloS one, 12(12), e0189490-e0189490 (2017-12-09)
MicroRNAs (miRNAs) are important regulators of pathobiological processes in various cancer. In the present study, we demonstrated that miR-93 expression was significantly up-regulated in gastric cancer tissues compared with that in matched normal mucosal tissues. High expression of miR-93 was
Yuan Cheng et al.
Molecular medicine reports, 16(4), 5464-5470 (2017-08-30)
Human papillomavirus (HPV) infection alone is not sufficient for development of cervical cancer and further risk factors are involved, however, the underlying mechanism remains to be elucidated. The authors previously used a microarray assay to reveal microR‑20b (miR‑20b) as a key
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique