Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU010991

Sigma-Aldrich

MISSION® esiRNA

targeting human SLC1A3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TTCTCCTTTCCTGGGGAACTTCTGATGAGGATGTTACAGATGCTGGTCTTACCACTTATCATCTCCAGTCTTGTCACAGGAATGGCGGCGCTAGATAGTAAGGCATCAGGGAAGATGGGAATGCGAGCTGTAGTCTATTATATGACTACCACCATCATTGCTGTGGTGATTGGCATAATCATTGTCATCATCATCCATCCTGGGAAGGGCACAAAGGAAAACATGCACAGAGAAGGCAAAATTGTACGAGTGACAGCTGCAGATGCCTTCCTGGACTTGATCAGGAACATGTTCCCTCCAAATCTGGTAGAAGCCTGCTTTAAACAGTTTAAAACCAACTATGAGAAGAGAAGCTTTAAAGTGCCCATCCAGGCCAACGAAACGCTTGTGGGTGCTGTGATAAACAATGTGTCTGAGGCCATGGAGACTCT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Classe de danger pour l'eau (WGK)

WGK 1

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hirofumi Nagao et al.
The Journal of biological chemistry, 292(11), 4469-4483 (2017-01-26)
Obesity is closely associated with various metabolic disorders. However, little is known about abnormalities in the metabolic change of obese adipose tissue. Here we use static metabolic analysis and
Thomas Bertero et al.
Cell metabolism, 29(1), 124-140 (2018-10-09)
Dysregulation of extracellular matrix (ECM) deposition and cellular metabolism promotes tumor aggressiveness by sustaining the activity of key growth, invasion, and survival pathways. Yet mechanisms by which biophysical properties of ECM relate to metabolic processes and tumor progression remain undefined.
Mylène Tajan et al.
Cell metabolism, 28(5), 721-736 (2018-08-21)
Numerous mechanisms to support cells under conditions of transient nutrient starvation have been described. Several functions of the tumor-suppressor protein p53 can contribute to the adaptation of cells to metabolic stress and help cancer cell survival under nutrient-limiting conditions. We

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique