Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

View All Documentation

EHU010021

Sigma-Aldrich

MISSION® esiRNA

targeting human GATA2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTACCTGTGCAATGCCTGTGGCCTCTACCACAAGATGAATGGGCAGAACCGACCACTCATCAAGCCCAAGCGAAGACTGTCGGCCGCCAGAAGAGCCGGCACCTGTTGTGCAAATTGTCAGACGACAACCACCACCTTATGGCGCCGAAACGCCAACGGGGACCCTGTCTGCAACGCCTGTGGCCTCTACTACAAGCTGCACAATGTTAACAGGCCACTGACCATGAAGAAGGAAGGGATCCAGACTCGGAACCGGAAGATGTCCAACAAGTCCAAGAAGAGCAAGAAAGGGGCGGAGTGCTTCGAGGAGCTGTCAAAGTGCATGCAGGAGAAGTCATCCCCCTTCAGTGCAGCTGCCCTGGCTGGACACATGGCACCTGTGGGCCACCTCCCGCCCTTCAGCCACTCCGGACACATCCTGCCCACTCCGACGCCCATCCACCCCTCCTCCAGCCTCTCCTTCGGCCACCCCCACCCGTCCAGCATGGTGACCGCCATGGGCTAGGGAACAGATGGACGTCGAGGAC

Numéro d'accès Ensembl | humain

ENSG00000179348

Numéro d'accès NCBI

NM_032638

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... GATA2(2624) , GATA2(2624)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Carole-Anne Whigham et al.
Scientific reports, 9(1), 235-235 (2019-01-20)
Preeclampsia is a pregnancy complication associated with elevated placental secretion of anti-angiogenic factors, maternal endothelial dysfunction and organ injury. GATA2 is a transcription factor expressed in the endothelium which regulates vascular homeostasis by controlling transcription of genes and microRNAs, including
Siyan Chen et al.
Molecular immunology, 123, 32-39 (2020-05-16)
At present, most studies on the relationship between hepatitis B virus (HBV) and IL-33/ST2 axis focus on clinical detection, but the underlying molecular mechanisms of HBx and IL-33/ST2 axis regulation and Th cell function regulation have not been explored. In
Fuwen Yuan et al.
Nucleic acids research, 47(19), 10104-10114 (2019-09-11)
Enzalutamide, a second-generation androgen receptor (AR) antagonist, has demonstrated clinical benefit in men with prostate cancer. However, it only provides a temporary response and modest increase in survival, indicating a rapid evolution of resistance. Previous studies suggest that enzalutamide may
Cong Qiu et al.
Nature communications, 8, 15426-15426 (2017-06-02)
Data from clinical research and our previous study have suggested the potential involvement of SENP1, the major protease of post-translational SUMOylation, in cardiovascular disorders. Here, we investigate the role of SENP1-mediated SUMOylation in graft arteriosclerosis (GA), the major cause of
Mark A Gillespie et al.
Molecular cell, 78(5), 960-974 (2020-04-25)
Dynamic cellular processes such as differentiation are driven by changes in the abundances of transcription factors (TFs). However, despite years of studies, our knowledge about the protein copy number of TFs in the nucleus is limited. Here, by determining the
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique