Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

View All Documentation

EHU009821

Sigma-Aldrich

MISSION® esiRNA

targeting human CHRM1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

TAGCCACAGTGACAGGCAACCTGCTGGTACTCATCTCTTTCAAGGTCAACACGGAGCTCAAGACAGTCAATAACTACTTCCTGCTGAGCCTGGCCTGTGCTGACCTCATCATCGGTACCTTCTCCATGAACCTCTATACCACGTACCTGCTCATGGGCCACTGGGCTCTGGGCACGCTGGCTTGTGACCTCTGGCTGGCCCTGGACTATGTGGCCAGCAATGCCTCCGTCATGAATCTGCTGCTCATCAGCTTTGACCGCTACTTCTCCGTGACTCGGCCCCTGAGCTACCGTGCCAAGCGCACACCCCGCCGGGCAGCTCTGATGATCGGCCTGGCCTGGCTGGTTTCCTTTGTGCTCTGGGCCCCAGCCATCCTCTTCTGGCAGTACCTGGTAGGGGAGCGGACAGTGCTAGCTGGGCAGTGCTACATCCAGTTCCTCTCCCAGCCCATCATCACCTTTGGCACAGCCATGGCTGCCTTCTACCTCCCTGTCACAGTCATGTGCACGCTCTACTGGCGCATCTACC

Numéro d'accès Ensembl | humain

ENSG00000168539

Numéro d'accès NCBI

NM_000738

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CHRM1(1128) , CHRM1(1128)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Deyu Zeng et al.
Journal of cellular biochemistry, 119(2), 1855-1865 (2017-08-13)
Pancreatic cancer is one of the major human malignant tumors severely endangering human health and life with high mortality due to the concealment of early symptoms and lack of effective therapies during advanced stages. The identification of pancreatic cancer stem
Jingjing Zhang et al.
Gynecologic and obstetric investigation, 84(5), 485-494 (2019-05-01)
The aim of this study was to investigate the expression of Forkhead box M1 (FoxM1) in endometriosis and determine FoxM1's possible effects on endometriotic epithelial cells (EECs) invasion and epithelial-mesenchymal transition (EMT). The expression of FoxM1 and E-cadherin in endometrium
Xinping Yang et al.
American journal of translational research, 10(2), 629-638 (2018-03-08)
The FoxM1 (Forkhead Box M1) transcription factor plays a key role in regulation of cell growth, cell cycle, and transformation. Higher expression of FoxM1 has been observed in various types of human cancers including bladder cancer. However, the exact function
Liang Guo et al.
Cell cycle (Georgetown, Tex.), 16(18), 1705-1718 (2017-08-03)
Ubiquitin-conjugating enzyme E2C (UBE2C) is characterized as a crucial molecule in cancer cell growth that plays an essential role in the development of gliomas, but the detailed mechanisms have not been fully elucidated. In this study, we found that Forkhead
Tao Wang et al.
Molecular and cellular biochemistry, 413(1-2), 179-187 (2016-01-29)
The prolyl isomerase Pin1, which is frequently highly expressed in many different cancers, can directly regulate cell proliferation and the cell cycle. However, the role of Pin1 in chemo-resistance remains to be elucidated in cervical cancer. The purpose of the
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique