Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU007971

Sigma-Aldrich

MISSION® esiRNA

targeting human UCP2

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CGTCTCCCACCCATTTTCTATGGAAAACCAAGGGGATCGGGCCATGATAGCCACTGGCAGCTTTGAAGAACGGGACACCTTTAGAGAAGCTTGATCTTGGAGGCCTCACCGTGAGACCTTACAAAGCCGGATTCCGGCAGAGTTCCTCTATCTCGTCTTGTTGCTGATTAAAGGTGCCCCTGTCTCCAGTTTTTCTCCATCTCCTGGGACGTAGCAGGAAATCAGCATCATGGTTGGGTTCAAGGCCACAGATGTGCCCCCTACTGCCACTGTGAAGTTTCTTGGGGCTGGCACAGCTGCCTGCATCGCAGATCTCATCACCTTTCCTCTGGATACTGCTAAAGTCCGGTTACAGATCCAAGGAGAAAGTCAGGGGCCAGTGCGCGCTACAGCCAGCGCCCAGTACCGCGGTGTGATGGGCACCATTCTGACCATGGTGCGTACTGAGGGCCCCCGAAGCCTCTACAATGGGCTGGTTGCCGGCCTGCAGCGCCAAATGAGCTTTGCCTCTGTCCGCATCGGCCTGTATGATTCT

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Anand Kumar Gupta et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 31(11), 5087-5101 (2017-08-03)
In visceral leishmaniasis, we found that the antileishmanial drug Amp B produces a higher level of IL-1β over the infected control. Moreover, administering anti-IL-1β antibody to infected Amp B-treated mice showed significantly less parasite clearance. Investigation revealed that
Corina T Madreiter-Sokolowski et al.
Oncotarget, 8(46), 80278-80285 (2017-11-09)
Cancer cells have developed unique strategies to meet their high energy demand. Therefore, they have established a setting of Ca
Jin Hee Lee et al.
Oncology letters, 20(6), 374-374 (2020-11-07)
The uncoupling protein-2 (UCP2) serves a role in tumor aggressiveness and anticancer resistance, which is considered to be associated with its ability to attenuate reactive oxygen species (ROS) production. We hypothesized that UCP2 may protect cancer cells from elesclomol-induced cytotoxicity
Rebecca F Hough et al.
JCI insight, 4(3) (2019-02-08)
Acid aspiration, which can result from several etiologies, including postoperative complications, leads to direct contact of concentrated hydrochloric acid (HCl) with the alveolar epithelium. As a result, rapid endothelial activation induces alveolar inflammation, leading to life-threatening pulmonary edema. Because mechanisms
Rui Zhang et al.
BioMed research international, 2020, 6537371-6537371 (2020-09-17)
As a common disorder, acute kidney injury (AKI) is characterized by high mortality and morbidity, and current therapeutic options for AKI remain limited. Irisin, a muscle factor, plays an important role in metabolic disorders. However, the role of irisin in

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique