Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

Autres documents

EHU005381

Sigma-Aldrich

MISSION® esiRNA

targeting human MDM4

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTGGGACGTCAGAGCTTCTCCGTGAAAGACCCAAGCCCTCTCTATGATATGCTAAGAAAGAATCTTGTCACTTTAGCCACTGCTACTACAGATGCTGCTCAGACTCTCGCTCTCGCACAGGATCACAGTATGGATATTCCAAGTCAAGACCAACTGAAGCAAAGTGCAGAGGAAAGTTCCACTTCCAGAAAAAGAACTACAGAAGACGATATCCCCACACTGCCTACCTCAGAGCATAAATGCATACATTCTAGAGAAGATGAAGACTTAATTGAAAATTTAGCCCAAGATGAAACATCTAGGCTGGACCTTGGATTTGAGGAGTGGGATGTAGCTGGCCTGCCTTGGTGGTTTTTAGGAAACTTGAGAAGCAACTATACACCTAGAAGTAATGGCTCAACTGATTTACAGACAAATCAGGATGTGGGTACTGCCATT

Numéro d'accès Ensembl | humain

ENSG00000198625

Numéro d'accès NCBI

NM_002393

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... MDM4(4194) , MDM4(4194)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Kehua Jiang et al.
Molecular genetics & genomic medicine, 7(8), e833-e833 (2019-06-30)
MicroRNA-33a (miR-33a) plays the role of the tumor suppressor gene by regulating the expression level of downstream genes. However, the effects of miR-33a in renal cell cancer (RCC) remain unknown. Our study was designed to investigate the expression level and
Haishan Zhang et al.
Molecular immunology, 125, 9-14 (2020-07-04)
MiR-483-3p is involved in the pathogenesis of acute myocardial infarctions, but its association with myocardial ischemia reperfusion (IR) remains mostly unknown. In this study, an in vitro model of myocardial IR injury was established by putting H9c2 cells into hypoxia
Hong Yan et al.
American journal of cancer research, 9(2), 312-329 (2019-03-25)
Activated KRAS is frequently observed and paralleled by inactivating of tumor suppressors in lung cancer, while the mechanisms remained elusive. Here, our study revealed a microRNA was involved in KRAS overexpression, activation of KRAS signaling and its synergy with inactivating
Yan Li et al.
Journal of molecular histology, 46(4-5), 357-364 (2015-06-21)
Multidrug resistance-associated protein 1 (MRP1) belongs to ATP-binding cassette transporters family. The overexpression of MRP1 is predominantly related with the failure of chemo-radiotherapy in various tumors. However, its possible role in hypertrophic scar (HS) is hardly investigated. Here we showed

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique