Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU004551

Sigma-Aldrich

MISSION® esiRNA

targeting human STS

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATTCATGGCGGAAGTAATGGGATCTATAAAGGAGGAAAAGCAAACAACTGGGAAGGAGGTATCCGGGTTCCAGGCATCCTTCGTTGGCCCAGGGTGATACAGGCTGGCCAGAAGATTGATGAGCCCACTAGCAACATGGACATATTTCCTACAGTAGCCAAGCTGGCTGGAGCTCCCTTGCCTGAGGACAGGATCATTGATGGACGTGATCTGATGCCCCTGCTTGAAGGAAAAAGCCAACGCTCCGATCATGAGTTTCTCTTCCATTACTGCAACGCCTACTTAAATGCTGTGCGCTGGCACCCTCAGAACAGCACATCCATCTGGAAGGCCTTTTTCTTCACCCCCAACTTCAACCCCGTGGGTTCCAACGGATGCTTTGCCACACACGTGTGCTTCTGTTTCGGGAGTTATGTCACCCATCACGACCCACCTTTAC

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... STS(412) , STS(412)

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Désolés, nous n'avons pas de COA pour ce produit disponible en ligne pour le moment.

Si vous avez besoin d'assistance, veuillez contacter Service Clients

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Hee-Jung Im et al.
Biomolecules & therapeutics, 20(6), 556-561 (2013-09-07)
Steroid sulfatase (STS) is responsiblefor the conversion of estrone sulfate to estrone that can stimulate growth in endocrine-dependent tumors such as prostate cancer. Although STS is considered as a therapeutic target for the estrogen-dependent diseases, cellular function of STS are
Cameron M Armstrong et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 26(22), 6064-6074 (2020-09-16)
Most patients with prostate cancer receiving enzalutamide or abiraterone develop resistance. Clinical evidence indicates that serum levels of dehydroepiandrosterone sulfate (DHEAS) and biologically active DHEA remain in the high range despite antiandrogen treatment. The conversion of DHEAS into DHEA by
Amy M Gratton et al.
Placenta, 48, 72-79 (2016-11-23)
Preeclampsia is a serious complication of pregnancy affecting 5% of pregnancies. Our team identified 137 genes highly expressed in placenta relative to other human tissues. Here, we have explored a role for steroid sulfatase (STS) in preeclampsia by characterising STS
Mengxi Jiang et al.
Journal of hepatology, 64(1), 44-52 (2015-07-30)
Chronic inflammatory liver diseases are associated with estrogen excess and feminization in men, which is thought to be due to compromised liver function to break down estrogens. The goal of this study is to determine whether the inflammatory induction of

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique