Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU001501

Sigma-Aldrich

MISSION® esiRNA

targeting human EGLN3

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

ATCGACAGGCTGGTCCTCTACTGCGGGAGCCGGCTGGGCAAATACTACGTCAAGGAGAGGTCTAAGGCAATGGTGGCTTGCTATCCGGGAAATGGAACAGGTTATGTTCGCCACGTGGACAACCCCAACGGTGATGGTCGCTGCATCACCTGCATCTACTATCTGAACAAGAATTGGGATGCCAAGCTACATGGTGGGATCCTGCGGATATTTCCAGAGGGGAAATCATTCATAGCAGATGTGGAGCCCATTTTTGACAGACTCCTGTTCTTCTGGTCAGATCGTAGGAACCCACACGAAGTGCAGCCCTCTTACGCAACCAGATATGCTATGACTGTCTGGTACTTTGATGCTGAAGAAAGGGCAGAAGCCAAAAAGAAATTCAGGAATTTAACTAGGAAAACTGAATCTGCCCTCACTGAAGACTGACCGTGCTCTGAAATCTGCTGGCCTTGTTCATTTTAGTAACGGTTCCTGAATTCTCTTAAATTCTTTGAGATCCAAAGATGGCCTCTTCAGTGACAACAATCTCCCTGCTACTTCTTGCATCCTTCACATCCCTGTCTTGTGTGTGG

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Yicun Wang et al.
Oncogene, 38(24), 4820-4834 (2019-02-28)
The chromosome 8q24.21 locus, which contains the proto-oncogene c-MYC, long non-coding RNA PVT1, and microRNAs (miRs), is the most commonly amplified region in human prostate cancer. A long-range interaction of genetic variants with c-MYC or long non-coding PVT1 at this
Lucia Bialesova et al.
Oncotarget, 8(44), 76622-76633 (2017-11-05)
The two estrogen receptor (ER) subtypes, ERα and ERβ, belong to the nuclear receptor superfamily. The human ERβ variant ERβ2 is proposed to be expressed at higher levels than ERβ1 in many breast tumors and it has been suggested that

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique