Accéder au contenu
Merck
Toutes les photos(1)

Principaux documents

EHU001311

Sigma-Aldrich

MISSION® esiRNA

targeting human PUM1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme


About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

CTCATGGTGGATGTGTTTGGTAATTACGTCATTCAGAAGTTCTTTGAATTTGGCAGTCTTGAACAGAAGCTGGCTTTGGCAGAACGGATTCGAGGCCACGTCCTGTCATTGGCACTACAGATGTATGGCTGCCGTGTTATCCAGAAAGCTCTTGAGTTTATTCCTTCAGACCAGCAGAATGAGATGGTTCGGGAACTAGATGGCCATGTCTTGAAGTGTGTGAAAGATCAGAATGGCAATCACGTGGTTCAGAAATGCATTGAATGTGTACAGCCCCAGTCTTTGCAATTTATCATCGATGCGTTTAAGGGACAGGTATTTGCCTTATCCACACATCCTTATGGCTGCCGAGTGATTCAGAGAATCCTGGAGCACTGTCTCCCTGACCAGACACTCCCTATTTTAGAGGAGCTTCACCAGCACACAGAGCAGCTTGTACAGGATCAATATGGAAATTATGTAATCCAACATGTACTGGAGCACGGTCGTCCTGAGGATAAAAGCAAAATTGTAGCAGAAATCCGAGGCAATGTACTTGTATTGAGTCAGCACAAATTTGCAAGCAATGTTGTGGAGAA

Numéro d'accès Ensembl | humain

Numéro d'accès NCBI

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

Description générale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Vous ne trouvez pas le bon produit ?  

Essayez notre Outil de sélection de produits.

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable


Faites votre choix parmi les versions les plus récentes :

Certificats d'analyse (COA)

Lot/Batch Number

Vous ne trouvez pas la bonne version ?

Si vous avez besoin d'une version particulière, vous pouvez rechercher un certificat spécifique par le numéro de lot.

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Marcin Sajek et al.
Cellular and molecular life sciences : CMLS, 76(1), 147-161 (2018-10-01)
Pumilio (PUM) proteins are RNA-binding proteins that posttranscriptionally regulate gene expression in many organisms. Their PUF domain recognizes specific PUM-binding elements (PBE) in the 3' untranslated region of target mRNAs while engaging protein cofactors such as NANOS that repress the
Kaibo Lin et al.
Cell reports, 26(9), 2434-2450 (2019-02-28)
Body and organ size regulation in mammals involves multiple signaling pathways and remains largely enigmatic. Here, we report that Pum1 and Pum2, which encode highly conserved PUF RNA-binding proteins, regulate mouse body and organ size by post-transcriptional repression of the

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique