Skip to Content
Merck
All Photos(1)

Key Documents

EMU029731

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Rb1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCAGGGCTGTGTTGACATCGGAGTACAGCGATATAAACTTGGAGTCCGATTGTATTACCGTGTGATGGAATCCATGCTTAAATCAGAAGAAGAACGTTTGTCCATTCAGAATTTTAGCAAACTCCTAAATGACAACATCTTTCATATGTCTTTACTGGCCTGTGCTCTTGAAGTTGTAATGGCTACGTATAGCAGAAGTACATTGCAGCATCTTGATTCTGGAACAGATTTGTCCTTCCCGTGGATTCTGAACGTACTTAATTTAAAAGCCTTTGATTTTTACAAAGTGATTGAAAGTTTTATCAAAGTGGAAGCCAACTTGACAAGAGAAATGATAAAACATTTAGAAAGATGTGAGCATCGAATCATGGAATCCCTTGCATGGCTTTCAGATTCACCTTTATTTGATCTCATTAAGCAGTCCAAGGATGGAGAAGGACCTGATAACCTTGAACCTGCTTGTCCTC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Yi-Xiang Zhang et al.
Molecular cancer therapeutics, 13(9), 2184-2193 (2014-07-17)
Well-differentiated/dedifferentiated liposarcomas (WD/DDLPS) are among the most common subtypes of soft tissue sarcomas. Conventional systemic chemotherapy has limited efficacy and novel therapeutic strategies are needed to achieve better outcomes for patients. The cyclin-dependent kinase 4 (CDK4) gene is highly amplified
Donald J Vander Griend et al.
International journal of biological sciences, 10(6), 627-642 (2014-06-21)
In normal prostate, androgen-dependent androgen receptor (AR) signaling within prostate stromal cells induces their secretion of paracrine factors, termed "andromedins" which stimulate growth of the epithelial cells. The present studies demonstrate that androgen-dependent andromedin-driven growth stimulation is counter-balanced by androgen-induced

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service