Skip to Content
Merck
All Photos(1)

Documents

EMU088711

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Atp11c

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTGAAAATGCAAAGCGAGTGAGGAAAGAAAGTGAAAAAATCAAGGTTGGTGATGTAGTAGAAGTACAGGCAAATGAAACCTTTCCCTGTGATCTTATACTTCTGTCATCCTGCACAACTGATGGAACCTGTTATGTCACTACAGCCAGTCTTGATGGTGAATCTAATTGCAAGACACATTATGCAGTACGAGATACCATTGCACTGTGTACAGCCGAATCCATTGATAATCTCCGAGCAACAATTGAATGTGAGCAGCCTCAACCTGATCTCTACAGGTTTGTTGGGCGAATCAGTATCTATAGTAATAGTATTGAGGCTGTTGCCAGGTCTTTGGGACCTGAAAATCTTTTGCTGAAAGGAGCCACACTTAAAAATACCAAGAAGATATATGGAGTTGCTGTTTACACTGGGATGGAAACCAAAATGGCTTTGAACTACCAAGGGAAATCTCAGAAATGTTCTGCTGTTGAAAAATCTATTAATGCCTTCTTGATTGTTTATTTATTTATCTTACTGACCAAAGCTGCAGTATGCA

Ensembl | mouse accession no.

ENSMUSG00000062949

NCBI accession no.

NM_001037863

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... ATP11C(320940) , Atp11c(320940)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Paweł Jóźwiak et al.
Nutrition and cancer, 67(8), 1333-1341 (2015-09-19)
Enhanced glucose requirement of cancer cells is associated with an increased glucose transport across plasma membrane that is mediated by a family of facilitated glucose transporter proteins, named GLUTs. GLUT1 is the main transporter in thyroid cancer cells. Glucose is
Michael Moldavan et al.
The European journal of neuroscience, 42(12), 3018-3032 (2015-09-24)
GABA is a principal neurotransmitter in the suprachiasmatic hypothalamic nucleus (SCN), the master circadian clock. Despite the importance of GABA and GABA uptake for functioning of the circadian pacemaker, the localization and expression of GABA transporters (GATs) in the SCN
Taryn E Travis et al.
Journal of burn care & research : official publication of the American Burn Association, 36(3), e125-e135 (2014-07-23)
The duroc pig has been described as a promising animal model for use in the study of human wound healing and scar formation. However, little is known about the presence and chronology of the fibrocyte cell population in the healing
Chong-Shan Shi et al.
Journal of immunology (Baltimore, Md. : 1950), 193(6), 3080-3089 (2014-08-20)
Coronaviruses (CoV) have recently emerged as potentially serious pathogens that can cause significant human morbidity and death. The severe acute respiratory syndrome (SARS)-CoV was identified as the etiologic agent of the 2002-2003 international SARS outbreak. Yet, how SARS evades innate
Edith Suzarte et al.
International immunology, 27(8), 367-379 (2015-03-22)
Our group developed a subunit vaccine candidate against dengue virus based on two different viral regions: the domain III of the envelope protein and the capsid protein. The novel chimeric protein from dengue-2 virus [domain III-capsid (DIIIC-2)], when presented as
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service