Recommended Products
description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
GGGTTGTTGTGGTTGGAGATCAGAGTGCTGGAAAGACTAGTGTGTTGGAAATGATTGCCCAAGCTCGAATATTCCCAAGAGGATCTGGGGAGATGATGACACGTTCTCCAGTTAAGGTGACTCTGAGTGAAGGTCCTCACCATGTGGCCCTATTTAAAGATAGTTCTCGGGAGTTTGATCTTACCAAAGAAGAAGATCTTGCAGCATTAAGACATGAAATAGAACTTCGAATGAGGAAAAATGTGAAAGAAGGCTGTACCG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... OPA1(4976) , OPA1(4976)
Related Categories
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Storage Class Code
10 - Combustible liquids
Flash Point(F)
Not applicable
Flash Point(C)
Not applicable
Choose from one of the most recent versions:
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Lucie Potuckova et al.
Frontiers in immunology, 9, 1771-1771 (2018-08-18)
C-terminal Src kinase (CSK) is a major negative regulator of Src family tyrosine kinases (SFKs) that play critical roles in immunoreceptor signaling. CSK is brought in contiguity to the plasma membrane-bound SFKs via binding to transmembrane adaptor PAG, also known
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU101391-20UG | 4061831357165 |
| EHU101391-50UG | 4061828372997 |
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service