Skip to Content
Merck
All Photos(1)

Key Documents

EHU080701

Sigma-Aldrich

MISSION® esiRNA

targeting human KARS

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGAAACAAGGTATCGCCAGAGATACTTGGACTTGATCCTGAATGACTTTGTGAGGCAGAAATTTATCATCCGCTCTAAGATCATCACATATATAAGAAGTTTCTTAGATGAGCTGGGATTCCTAGAGATTGAAACTCCCATGATGAACATCATCCCAGGGGGAGCCGTGGCCAAGCCTTTCATCACTTATCACAACGAGCTGGACATGAACTTATATATGAGAATTGCTCCAGAACTCTATCATAAGATGCTTGTGGTTGGTGGCATCGACCGGGTTTATGAAATTGGACGCCAGTTCCGGAATGAGGGGATTGATTTGACGCACAATCCTGAGTTCACCACCTGTGAGTTCTACATGGCCTATGCAGACTATCACGATCTCATGGAAATCACGGAGAAGATGG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Seo Hee Nam et al.
Oncotarget, 6(25), 21655-21674 (2015-06-20)
The adhesion properties of cells are involved in tumor metastasis. Although KRS at the plasma membrane is shown important for cancer metastasis, additionally to canonical roles of cytosolic KRS in protein translation, how KRS and its downstream effectors promote the
Seo Hee Nam et al.
The Journal of clinical investigation, 128(11), 5034-5055 (2018-09-07)
Lysyl-tRNA synthetase (KRS) functions canonically in cytosolic translational processes. However, KRS is highly expressed in colon cancer, and localizes to distinct cellular compartments upon phosphorylations (i.e., the plasma membranes after T52 phosphorylation and the nucleus after S207 phosphorylation), leading to

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service