Skip to Content
Merck
All Photos(1)

Key Documents

EHU069871

Sigma-Aldrich

MISSION® esiRNA

targeting human NRF1

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAGTGACCCAAACCGAACATATGGCTACCATAGAAGCACATGCAGTGGCCCAGCAAGTGCAGCAGGTCCATGTGGCTACTTACACCGAGCATAGTATGCTGAGTGCTGATGAAGACTCGCCTTCTTCTCCCGAGGACACCTCTTACGATGACTCAGATATACTCAACTCCACAGCAGCTGATGAGGTGACAGCTCATCTGGCAGCTGCAGGTCCTGTGGGAATGGCCGCTGCTGCTGCTGTGGCAACAGGAAAGAAACGGAAACGGCCTCATGTATTTGAGTCTAATCCATCTATCCGGAAGAGGCAACAAACACGTTTGCTTCGGAAACTTCGAGCCACGTTAGATGAATATACTACTCGTGTGGGACAGCAAGCTATTGTCCTCTGTATCTCACCCTCCAAACCTAACCCTGTCTTTAAAGTGTTTGGTGCAGCACCTTTGGAGAATGTGGTGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Victoria Sid et al.
Journal of molecular medicine (Berlin, Germany), 96(11), 1203-1213 (2018-09-05)
Folate is an essential micronutrient for biological function. The liver, a primary organ for folate metabolism and storage, plays an important role in folate homeostasis. Proton-coupled folate transporter (PCFT) and reduced folate carrier (RFC) are the major folate transporters responsible
Luqing Zhao et al.
Oncotarget, 6(18), 15995-16018 (2015-07-24)
microRNAs (miRNAs) are involved in the various processes of DNA damage repair and play crucial roles in regulating response of tumors to radiation therapy. Here, we used nasopharyngeal carcinoma (NPC) radio-resistant cell lines as models and found that the expression
V O Okoh et al.
British journal of cancer, 112(10), 1687-1702 (2015-05-13)
17β-Oestradiol (E2)-induced reactive oxygen species (ROS) have been implicated in regulating the growth of breast cancer cells. However, the underlying mechanism of this is not clear. Here we show how ROS through a novel redox signalling pathway involving nuclear respiratory

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service