Skip to Content
Merck
All Photos(1)

Key Documents

EHU062441

Sigma-Aldrich

MISSION® esiRNA

targeting human SEPT9

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGCCAGGAGGCCACTGAGGCGGCTCCCAGCTGCGTTGGCGACATGGCCGACACCCCCAGAGATGCCGGGCTCAAGCAGGCGCCTGCATCACGGAACGAGAAGGCCCCGGTGGACTTCGGCTACGTGGGGATTGACTCCATCCTGGAGCAGATGCGCCGGAAGGCCATGAAGCAGGGCTTCGAGTTCAACATCATGGTGGTCGGGCAGAGCGGCTTGGGTAAATCCACCTTAATCAACACCCTCTTCAAATCCAAAATCAGCCGGAAGTCGGTGCAGCCCACCTCAGAGGAGCGCATCCCCAAGACCATCGAGATCAAGTCCATCACGCACGATATTGAGGAGAAAGGCGTCCGGATGAAGCTGACAGTGATTGACACACCAGGGTTCGGGGACCACATCAACAACGAGAACTGCTGG

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Beatrice Stubendorff et al.
Journal of cancer research and clinical oncology, 145(4), 811-820 (2019-01-04)
In this study, we aimed to identify a DNA methylation pattern suitable for prognosis assessment of muscle-invasive bladder cancer and to investigate metastasis-associated processes regulated by DNA methylation. Genome-wide methylation analysis was performed on 23 muscle-invasive bladder tumors by microarray
Ilona A Kesisova et al.
The Journal of cell biology, 220(2) (2021-01-09)
The metabolic and signaling functions of lysosomes depend on their intracellular positioning and trafficking, but the underlying mechanisms are little understood. Here, we have discovered a novel septin GTPase-based mechanism for retrograde lysosome transport. We found that septin 9 (SEPT9)

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service