Skip to Content
Merck
All Photos(1)

Key Documents

EHU021771

Sigma-Aldrich

MISSION® esiRNA

targeting human HSD17B4

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCCAGCAAGCCTCAGAGTATCCAAGAATCAACTGGCAGTATAATTGAAGTTCTGAGTAAAATAGATTCAGAAGGAGGAGTTTCAGCAAATCATACTAGTCGTGCAACGTCTACAGCAACATCAGGATTTGCTGGAGCTATTGGCCAGAAACTCCCTCCATTTTCTTATGCTTATACGGAACTGGAAGCTATTATGTATGCCCTTGGAGTGGGAGCGTCAATCAAGGATCCAAAAGATTTGAAATTTATTTATGAAGGAAGTTCTGATTTCTCCTGTTTGCCCACCTTCGGAGTTATCATAGGTCAGAAATCTATGATGGGTGGAGGATTAGCAGAAATTCCTGGACTTTCAATCAACTTTGCAAAGGTTCTTCATGGAGAGCAGTACTTAGAGTTATATAAACCACTTCCCAGAGCAGGAAAA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Not finding the right product?  

Try our Product Selector Tool.

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Mykhaylo S Frasinyuk et al.
Organic & biomolecular chemistry, 15(36), 7623-7629 (2017-09-05)
Cytisine-linked isoflavonoids (CLIFs) inhibited PC-3 prostate and LS174T colon cancer cell proliferation by inhibiting a peroxisomal bifunctional enzyme. A pull-down assay using a biologically active, biotin-modified CLIF identified the target of these agents as the bifunctional peroxisomal enzyme, hydroxysteroid 17β-dehydrogenase-4
Domenica Roberto et al.
The Prostate, 79(15), 1777-1788 (2019-09-11)
Gleason grade is among the most powerful clinicopathological classification systems used to assess risk of lethal potential in prostate cancer, yet its biologic basis is poorly understood. Notably, pure low-grade cancers, comprised predominantly of Gleason pattern 3 (G3) are typically

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service