Direkt zum Inhalt
Merck

EMU208701

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Dlc1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGCAAAGAAAACAGAGTTTGGGCAAACCAGACCAGAAAGACCTGAATGAAAACCTAGCGGCGACTCAAGGGCTGGCCCACATGATTGCTGAGTGCAAGAAGCTCTTCCAGGTCCCTGAGGAAATGAGCCGGTGCCGTAACTCCTACACTGAACAAGAGCTGAAGCCCCTTACCCTGGAGGCCTTGGGACACCTGAATAGTGACCAGCCTGCTGACTACAGACACTTCCTCCAGGACTGTGTGGATGGCCTGTTTAAGGAGGTCAAAGAGAAGTTCAAAGGCTGGGTCAGCTACCCCACCTCCGAACAGGCTGAGCTGTCCTATAAGAAGGTCAGCGAAGGACCCCCGTTAAGGCTTTGGAGGTCAACTATCGAAGTCCCCGCTGCACCCGAGGAGATCTTAAAGCGCCTTCTGAAGGAGCAACACCTCTGGGATGTGGACCTGCTGGACTCCAAGGTGATTGAAATCCTGGACAGCCAGACTGAAATCTACCAATACGTCCAAAACAGCA

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Mohammad Golam Sabbir et al.
PloS one, 7(7), e40302-e40302 (2012-07-14)
The Deleted in liver cancer one (Dlc1) tumor suppressor gene encodes a RhoGTPase activating protein (RhoGAP). The Dlc1 gene has multiple transcriptional isoforms and we have previously established a mouse strain containing a gene trap (gt) insertion, which specifically reduces
Ho-Suk Mun et al.
Scientific reports, 5, 17697-17697 (2015-12-08)
Understanding the mechanisms of memory formation is fundamental to establishing optimal educational practices and restoring cognitive function in brain disease. Here, we show for the first time in a non-primate species, that spatial learning receives a special bonus from self-directed
Yi-Ping Shih et al.
Biochimica et biophysica acta, 1853(12), 3258-3265 (2015-10-03)
DLC1 is a RhoGAP-containing tumor suppressor and many of DLC1's functions are absolutely dependent on its RhoGAP activity. Through its RhoGAP domain, DLC1 inhibits the activity of RhoA GTPase, which regulates actin cytoskeleton networks and dis/assembly of focal adhesions. Tensin1
Tomofumi Fujino et al.
The Journal of toxicological sciences, 40(4), 501-508 (2015-07-15)
Identification of substances with specific toxicity for carcinoma cells promises to facilitate the development of cancer chemotherapeutics that cause minimal side effects. Here, we show that knockdown of the farnesoid X receptor (FXR) effectively suppresses the proliferation of human hepatocellular

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.