Direkt zum Inhalt
Merck

EMU202811

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ptprc

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TAAATACTATGAAGTGTCCCTACTTGCCTATGTCAATGGGAAGATTCAAAGAAATGGGACTGCTGAGAAGTGCAATTTTCACACAAAAGCAGATCGTCCGGACAAGGTCAATGGAATGAAAACCTCCCGGCCGACAGACAATAGTATAAATGTTACATGTGGTCCTCCTTATGAAACTAATGGCCCTAAAACCTTTTACATTTTGGTAGTCAGAAGTGGAGGTTCTTTTGTTACAAAATACAACAAGACAAACTGTCAGTTTTATGTAGATAATCTCTACTATTCAACTGACTATGAGTTTCTGGTCTCTTTTCACAATGGAGTGTACGAGGGAGATTCAGTTATAAGAAATGAGTCAACAAATTTTAATGCTAAAGCACTGATTATATTCCTGGTGTTTCTGATTATTGTGACATCAATAGCCTTGCTTGTTGTTTTGTATAAAATCTATGATCTGCGCAAGAAAAGATCCAGCAATTTAGATGAACAACAGGAACTCGTTGAAAGGGA

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Iwona Grabowska et al.
Journal of muscle research and cell motility, 36(6), 395-404 (2015-11-29)
The skeletal muscle injury triggers the inflammatory response which is crucial for damaged muscle fiber degradation and satellite cell activation. Immunodeficient mice are often used as a model to study the myogenic potential of transplanted human stem cells. Therefore, it
Asif Manzoor Khan et al.
Neurobiology of aging, 36(6), 2164-2175 (2015-04-22)
The susceptibility of the aging brain to neurodegenerative disease may in part be attributed to cellular aging of the microglial cells that survey it. We investigated the effect of cellular aging induced by telomere shortening on microglia by the use
Chiyoko Sekine et al.
Arthritis & rheumatology (Hoboken, N.J.), 66(10), 2751-2761 (2014-06-20)
We previously reported that blockade of the Notch ligand delta-like protein 1 (DLL-1) suppressed osteoclastogenesis and ameliorated arthritis in a mouse model of rheumatoid arthritis (RA). However, the mechanisms by which joint inflammation were suppressed have not yet been revealed.
Xu Chang Geng et al.
Molecular medicine reports, 11(5), 3860-3865 (2015-01-13)
Erythropoietin (EPO) is a hematopoietic hormone that protects against renal interstitial fibrosis in animal models; however, the mechanism underlying the anti‑fibrotic activity of EPO has remained elusive. The present study aimed to elucidate this mechanism. Twenty‑four male C57BL6 mice were
Kunitoshi Kobayashi et al.
International immunology, 27(7), 333-344 (2015-02-28)
Dimethyl fumarate (DMF) is a modifier of the nuclear factor (erythroid-derived 2)-2 (Nrf2)-kelch-like ECH-associated protein 1 (Keap1) pathway. DMF treatment in the effector phase significantly suppressed the development of Theiler's murine encephalomyelitis virus-induced demyelinating disease (TMEV-IDD) both clinically and histologically.

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.