Direkt zum Inhalt
Merck

EMU195961

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Srebf2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CATTCTGACCACAATGCCTGTGATGATGGGGCAAGAGAAAGTTCCTATCAAGCAAGTGCCTGGCGGCGTGAAGCAGCTGGATCCTCCCAAAGAAGGAGAGAGGCGGACAACACACAATATCATTGAAAAGCGCTACCGGTCCTCCATCAACGACAAAATCATAGAGTTGAAGGACTTAGTCATGGGGACAGATGCCAAGATGCACAAGTCTGGCGTTCTGAGGAAGGCCATTGATTACATCAAATATCTGCAGCAGGTCAATCACAAGCTGCGCCAGGAGAACATGGTGCTGAAGCTGGCCAATCAGAAAAACAAGCTCCTGAAGGGCATCGACCTGGGCAGTCTGGTGGACAGTGATGTGGACTTGAAAATTGATGACTTTAACCAGAATGTCCTTCTGATGTCTCCGCCGGCCTCCGACTCCGGGTCCCAGGCCGGCTTCTCTCCCTATTCCATTGACTCTGAGCCGGGCAGCCCTCTGCTGGATGACGCAAAGGTCAAGGATGAACC

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Young-Chae Kim et al.
Genome biology, 16, 268-268 (2015-12-05)
Fibroblast growth factor-19 (FGF19) is an intestinal hormone that mediates postprandial metabolic responses in the liver. The unusual orphan nuclear receptor, small heterodimer partner (SHP), acts as a co-repressor for many transcriptional factors and has been implicated in diverse biological
Ji Miao et al.
Nature communications, 6, 6498-6498 (2015-04-08)
Despite the well-documented association between insulin resistance and cardiovascular disease, the key targets of insulin relevant to the development of cardiovascular disease are not known. Here, using non-biased profiling methods, we identify the enzyme flavin-containing monooxygenase 3 (Fmo3) to be
Kazuki Inoue et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 29(8), 1823-1832 (2014-03-29)
Clarification of the mechanisms underlying osteoclast differentiation enables us to understand the physiology of bone metabolism as well as the pathophysiology of bone diseases such as osteoporosis. Recently, it has been reported that epigenetics can determine cell fate and regulate
Kenji Fukui et al.
The Journal of biological chemistry, 290(44), 26383-26392 (2015-09-16)
Diabetes mellitus is associated with a variety of complications, including alterations in the central nervous system (CNS). We have recently shown that diabetes results in a reduction of cholesterol synthesis in the brain due to decreased insulin stimulation of SREBP2-mediated

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.