Direkt zum Inhalt
Merck

EMU150581

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Camk2a

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TCTGAGAGCACCAACACCACCATTGAGGACGAAGACACCAAAGTGCGCAAACAGGAAATTATCAAAGTGACAGAGCAGCTGATCGAAGCCATAAGCAATGGAGACTTTGAGTCCTACACGAAGATGTGCGACCCTGGAATGACAGCCTTTGAACCAGAGGCCCTGGGGAACCTGGTGGAGGGCCTGGACTTTCATCGATTCTATTTTGAAAACCTGTGGTCCCGGAACAGCAAGCCCGTGCACACCACCATCCTGAACCCTCACATCCACCTGATGGGTGACGAGTCAGCCTGCATCGCCTATATCCGCATCACTCAGTACCTGGATGCAGGCGGCATACCCCGCACGGCCCAGTCAGAGGAGACCCGCGTCTGGCACCGCAGGGACGGCAAATGGCAGATCGTCCACTTCCACAGATCTGGGGCGCCCTCCGTCCTGCCGCATTGAAGGACCAGGCCAGGGTCCCTGCGTCCTTGCTTCGCAGAGATCCGCTCTTTGTCCGTGGAATGT

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Tae-Kyung Kim et al.
Neurobiology of disease, 79, 59-69 (2015-04-29)
Physical exercise is considered beneficial in the treatment of depression, but the underlying mechanism is not clearly understood. In the present study, we investigated the mechanism regulating antidepressant effects of exercise by focusing on the role of the amygdala using
Jie-Min Jia et al.
The Journal of neuroscience : the official journal of the Society for Neuroscience, 34(41), 13725-13736 (2014-10-10)
Dysbindin is a schizophrenia susceptibility gene required for the development of dendritic spines. The expression of dysbindin proteins is decreased in the brains of schizophrenia patients, and neurons in mice carrying a deletion in the dysbindin gene have fewer dendritic
Xueyuan Zhou et al.
Immunology, 143(2), 287-299 (2014-04-30)
Prostaglandin E2 (PGE2 ) is an important inducer of inflammation, which is also closely linked to the progress of tumours. In macrophages, PGE2 production is regulated by arachidonic acid release and cyclooxygenase-2 (COX-2) expression. In the present study, we found
Luan Pereira Diniz et al.
Glia, 62(12), 1917-1931 (2014-07-22)
The balance between excitatory and inhibitory synaptic inputs is critical for the control of brain function. Astrocytes play important role in the development and maintenance of neuronal circuitry. Whereas astrocytes-derived molecules involved in excitatory synapses are recognized, molecules and molecular
Paul G Daft et al.
PloS one, 10(4), e0121568-e0121568 (2015-04-11)
Osteosarcoma (OS) is a hyperproliferative malignant tumor that requires a high vascular density to maintain its large volume. Vascular Endothelial Growth Factor (VEGF) plays a crucial role in angiogenesis and acts as a paracrine and autocrine agent affecting both endothelial

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.