Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EMU077471

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Thbd

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGCCAGGCTCTTACTCCTGTATGTGTGAGACAGGCTACCAGTTGGCTGCAGACGGACACCGGTGTGAGGACGTGGATGACTGTAAGCAGGGGCCCAATCCATGTCCCCAGCTCTGTGTTAACACCAAGGGCGGCTTCGAATGCTTCTGCTATGATGGCTATGAGTTGGTGGATGGAGAGTGCGTGGAGCTTCTGGATCCGTGTTTCGGATCTAACTGCGAGTTTCAGTGCCAGCCAGTGAGCCCCACCGACTACCGATGCATCTGCGCTCCAGGCTTCGCACCCAAGCCGGATGAACCGCACAAGTGCGAAATGTTCTGCAATGAAACTTCGTGCCCAGCAGACTGTGACCCTAACTCTCCTACTGTTTGTGAATGCCCTGAAGGCTTCATCCTGGACGAGGGTTCCGTATGCACGGACATTGATGAGTGCAGTCAAGGCGAATGCTTCAC

Ensembl | Maus Hinterlegungsnummer

ENSMUSG00000074743

NCBI-Hinterlegungsnummer

NM_009378

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

mouse ... THBD(21824) , Thbd(21824)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Shahin Assefnia et al.
Oncotarget, 5(6), 1458-1474 (2014-04-01)
Cadherin-11 (CDH11), associated with epithelial to mesenchymal transformation in development, poor prognosis malignancies and cancer stem cells, is also a major therapeutic target in rheumatoid arthritis (RA). CDH11 expressing basal-like breast carcinomas and other CDH11 expressing malignancies exhibit poor prognosis.
Minttu Kansikas et al.
Human mutation, 35(9), 1123-1127 (2014-06-14)
Lynch syndrome (LS), the most common familial colon cancer, is associated with mismatch repair (MMR) malfunction. As mutation carriers inherit one normal and one defected MMR gene allele, cancer risk can be considered as limited amount of normal MMR gene
O Richmond et al.
Veterinary microbiology, 180(3-4), 223-229 (2015-10-09)
Porcine circovirus type 2 (PCV2) and porcine reproductive and respiratory syndrome virus (PRRSV) continue to have a negative economic impact on global swine production operations. Host immune modulations that potentiate disease during PCV2 and/or PRRSV infections are important areas of
E Klineberg et al.
European spine journal : official publication of the European Spine Society, the European Spinal Deformity Society, and the European Section of the Cervical Spine Research Society, 23(11), 2385-2392 (2014-04-18)
Noggin protein levels and spinal fusion rates were compared in a rabbit model after application of siRNA against BMP antagonist noggin in paraspinal muscle. To test whether endogenous BMPs are sufficient to form bone in the absence of their antagonists
Yi Liu et al.
Journal of proteomics, 106, 99-112 (2014-04-29)
Chronic hepatitis B virus (HBV) infection is a major risk factor for hepatocellular carcinoma (HCC), the sixth most common cancer worldwide. To explore potential biomarkers for HCC, iTRAQ coupled with mass spectrometry was used to analyze proteins in plasma from
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.