Direkt zum Inhalt
Merck

EMU071351

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Src

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ACGAGGAAGGTGGATGTCAGAGAGGGAGACTGGTGGCTGGCACACTCGCTGAGCACGGGACAGACCGGTTACATCCCCAGCAACTATGTGGCGCCCTCCGACTCCATCCAGGCTGAGGAGTGGTACTTTGGCAAGATCACTAGACGGGAATCAGAGCGGCTGCTGCTCAACGCCGAGAACCCGAGAGGGACCTTCCTCGTGAGGGAGAGTGAGACCACAAAAGGTGCCTACTGCCTCTCTGTATCCGACTTCGACAATGCCAAGGGCCTAAATGTGAAACACTACAAGATCCGCAAGCTGGACAGCGGCGGTTTCTACATCACCTCCCGCACCCAGTTCAACAGCCTGCAGCAGCTCGTGGCTTACTACTCCAAACATGCTGATGGCCTGTGTCACCGCCTCACTACCGTATGTCCCACATCCAAGCCT

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

12 - Non Combustible Liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Xiaohua Guo et al.
PloS one, 15(4), e0231739-e0231739 (2020-05-01)
We previously reported microvascular leakage resulting from fibrinogen-γ chain C-terminal products (γC) occurred via a RhoA-dependent mechanism. The objective of this study was to further elucidate the signaling mechanism by which γC induces endothelial hyperpermeability. Since it is known that
M Katie Conley-LaComb et al.
Molecular cancer, 15(1), 68-68 (2016-11-05)
The CXCL12/CXCR4 axis transactivates HER2 and promotes intraosseous tumor growth. To further explore the transactivation of HER2 by CXCL12, we investigated the role of small GTP protein G We used a variety of methods such as lipid raft isolation, invasion
Wei Liu et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 32(6), 3033-3046 (2018-02-07)
Hepatitis B virus core protein (HBc) is expressed preferentially in hepatitis B virus (HBV)-associated hepatocellular carcinoma (HCC). HBc can function as an oncogene arising from its gene regulatory properties, but how it contributes functionally to hepatocarcinogenesis remains unclear. In this
Jun Wang et al.
Oncotarget, 8(48), 83872-83889 (2017-11-16)
Src has been reported to mediate tissue fibrosis in several organs, but its role in peritoneal fibrosis remains unknown. In this study, we evaluated the therapeutic effect of KX2-391, a highly selective inhibitor of Src, on the development of peritoneal
Yiming Liu et al.
Journal of cellular and molecular medicine, 23(4), 2399-2409 (2019-01-25)
Golgi phosphoprotein 73 (GP73) has been regarded as a novel serum biomarker for the diagnosis of hepatocellular carcinoma (HCC) in recent years. It has been reported that the upregulation of GP73 may promote the carcinogenesis and metastasis of HCC; however

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.