Direkt zum Inhalt
Merck

EMU028161

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cdc2a

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ACGAATCTCTGGCAAAATGGCCCTGAAGCACCCGTACTTTGATGACTTGGACAATCAGATTAAGAAGATGTAGCCCTCTGGATGGATGTCCCTGTCTGCTGGTCGTAGGGGAAGATCGTGTTGTTTACCGTTGGCTCTCTTCCTGTCTTGTATAGTTTTCTTTGTTTGTAAACTGTCATCTGGACTTTTCTTAATTTCCTACGTATAACTTAATTAACATGTAAATATTATTCCATATGAATTTAAATATAATTCTGTATATGTGCAGATGTCACTGTGGTGGCTGTTAATTACTATAACACAAGTGTTAATTACTACAACATAAGACTTGAGTCTCCCTAGACTTCCCAGCAGCCATTCCTGCAGCTCGGAGCACAGTTGAAGGAGCTGAGCTCAGGCCTCGTGATGCTTTCAAGTGCCTCCGTGTTCTGGATATATATGATTCCTGGTCAGTTTCTTGCC

Ensembl | Maus Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Griselda Vallejo et al.
PloS one, 9(5), e97311-e97311 (2014-05-27)
Although non-genomic steroid receptor pathways have been studied over the past decade, little is known about the direct gene expression changes that take place as a consequence of their activation. Progesterone controls proliferation of rat endometrial stromal cells during the
Gunjan Guha et al.
PloS one, 10(5), e0125322-e0125322 (2015-05-06)
Pactamycin, although putatively touted as a potent antitumor agent, has never been used as an anticancer drug due to its high cytotoxicity. In this study, we characterized the effects of two novel biosynthetically engineered analogs of pactamycin, de-6MSA-7-demethyl-7-deoxypactamycin (TM-025) and
Qinghua Xi et al.
Tumour biology : the journal of the International Society for Oncodevelopmental Biology and Medicine, 36(7), 4939-4948 (2015-04-26)
Overexpression of cyclin-dependent kinase 1 (CDK1) has been noted to correlation with several human cancers. However, the effects of CDK1 on ovarian cancer development remain unclear. The aim of this study was to examine the effect of CDK1 and related
Qing Xia et al.
International journal of oncology, 44(3), 735-744 (2014-01-01)
Breast cancer is one of the most common malignancies in women. Approximately 15% of the patients belong to the triple-negative breast cancer (TNBC) group, and have the disadvantage of not benefiting from currently available receptor-targeted systemic therapies. Some cancers in

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.