Direkt zum Inhalt
Merck

EHU156781

Sigma-Aldrich

MISSION® esiRNA

targeting human TRPV4

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GCGAGGTCATTACGCTCTTCACTGGGGTCCTGTTCTTCTTCACCAACATCAAAGACTTGTTCATGAAGAAATGCCCTGGAGTGAATTCTCTCTTCATTGATGGCTCCTTCCAGCTGCTCTACTTCATCTACTCTGTCCTGGTGATCGTCTCAGCAGCCCTCTACCTGGCAGGGATCGAGGCCTACCTGGCCGTGATGGTCTTTGCCCTGGTCCTGGGCTGGATGAATGCCCTTTACTTCACCCGTGGGCTGAAGCTGACGGGGACCTATAGCATCATGATCCAGAAGATTCTCTTCAAGGACCTTTTCCGATTCCTGCTCGTCTACTTGCTCTTCATGATCGGCTACGCTTCAGCCCTGGTCTCCCTCCTGAACCCGTGTGCCAACATGAAGGTGTGCAATGAGGACCAGACCAACTGCACAGTGCCCACTTACCCCTCGTGCCGTGACAGCGAGACCTTCAGCACCTTCCTCCTGGACCTGTT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Yuanzheng Gu et al.
The Journal of cell biology, 216(7), 2179-2199 (2017-06-14)
Little is known about mechanical regulation of morphological and functional polarity of central neurons. In this study, we report that mechanical stress specifically induces varicosities in the axons but not the dendrites of central neurons by activating TRPV4, a Ca
Hengli Zhao et al.
Frontiers in molecular neuroscience, 11, 97-97 (2018-04-11)
Blood-brain barrier (BBB) disruption and subsequent brain edema play important roles in the secondary neuronal death and neurological dysfunction that are observed following intracerebral hemorrhage (ICH). In previous studies, transient receptor potential vanilloid 4 (TRPV4), a calcium-permeable mechanosensitive channel, was
Bo Xu et al.
Life sciences, 228, 158-166 (2019-05-06)
Chondrocyte apoptosis is the most common pathological feature of cartilage in osteoarthritis (OA). Excessive mechanical stress can induce chondrocyte apoptosis and destroy cartilage tissue. Transient receptor potential channel vanilloid 4 (TRPV4) is a mechanosensitive ion channel that mediates chondrocyte response
Boran Cao et al.
Journal of cellular physiology, 234(5), 6831-6841 (2018-11-06)
The aim of this study is to evaluate the effect of transient receptor potential vanilloid 4 (TRPV4) on osteoclast differentiation and osteoporosis, and to investigate the underlying mechanism. The results showed that TRPV4 expression and intracellular Ca2+ concentration were significantly
Tatsuya Ihara et al.
Neurourology and urodynamics, 37(8), 2535-2543 (2018-08-15)
The sensation of bladder fullness (SBF) is triggered by the release of ATP. Therefore, the aim of this study was to investigate whether time-dependent changes in the levels of stretch-released ATP in mouse primary-cultured urothelial cells (MPCUCs) is regulated by

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.