Direkt zum Inhalt
Merck

EHU153841

Sigma-Aldrich

MISSION® esiRNA

targeting human NFKB1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCAGGGTATAGCTTCCCACACTATGGATTTCCTACTTATGGTGGGATTACTTTCCATCCTGGAACTACTAAATCTAATGCTGGGATGAAGCATGGAACCATGGACACTGAATCTAAAAAGGACCCTGAAGGTTGTGACAAAAGTGATGACAAAAACACTGTAAACCTCTTTGGGAAAGTTATTGAAACCACAGAGCAAGATCAGGAGCCCAGCGAGGCCACCGTTGGGAATGGTGAGGTCACTCTAACGTATGCAACAGGAACAAAAGAAGAGAGTGCTGGAGTTCAGGATAACCTCTTTCTAGAGAAGGCTATGCAGCTTGCAAAGAGGCATGCCAATGCCCTTTTCGACTACGCGGTGACAGGAGACGTGAAGATGCTGCTGGCCGTCCAGCGCCATCTCACTGCTGTGCAGGATGAGAATGGGGACAGTGTCTTACACTTAGCAATCATCCACCTTCATTCTCAACTTGTGAGGGATCTACTAGAAGTCACATCTGGTTTGATTTCTGATGACATTATCAACATGAGAAATGATCTGTACCAGACGCCC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Jie Song et al.
Molecular carcinogenesis, 56(1), 36-48 (2016-02-10)
Inflammatory microenvironment created by immune cells is favorable for tumor metastasis. Epithelial-mesenchymal transition (EMT) is involved in the progression of cancer invasion and metastasis in inflammatory microenvironment. In this study, we sought to investigate the effects of Icariside II, a
Zhihong Yuan et al.
Scientific reports, 7, 42028-42028 (2017-02-10)
Triggering receptor expressed on myeloid cells-1(TREM-1) is a member of the superimmunoglobulin receptor family. We have previously shown that TREM-1 prolongs survival of macrophages treated with lipoolysaccharide through Egr2-Bcl2 signaling. Recent studies suggest a role for TREM-1 in viral immunity.
Jing Zhou et al.
BioMed research international, 2018, 1650456-1650456 (2018-11-08)
Intermittent hypoxia (IH) that resulted from obstructive sleep apnea (OSA) has been found to be a risk factor of coronary artery disease. IH and the receptor for advanced glycation end products (RAGE) expression are known to activate monocyte/macrophage and associated
Yunxia Guo et al.
Cytotechnology, 73(1), 115-126 (2021-01-29)
This study intended to investigate the role of NFKB1 in oxidative stress injury and insulin resistance in gestational hypertension (GH) mice. Following establishment of a GH mouse model by high-fat diet, NFKB1, miR-106a, and FLOT2 expression was detected in liver
Shayna E Thomas-Jardin et al.
The Prostate, 80(2), 133-145 (2019-11-16)
The androgen receptor (AR) nuclear transcription factor is a therapeutic target for prostate cancer (PCa). Unfortunately, patients can develop resistance to AR-targeted therapies and progress to lethal disease, underscoring the importance of understanding the molecular mechanisms that underlie treatment resistance.

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.