Direkt zum Inhalt
Merck

EHU149771

Sigma-Aldrich

MISSION® esiRNA

targeting human T

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCGTCTCCTTCAGCAAAGTCAAGCTCACCAACAAGCTCAACGGAGGGGGCCAGATCATGCTGAACTCCTTGCATAAGTATGAGCCTCGAATCCACATAGTGAGAGTTGGGGGTCCACAGCGCATGATCACCAGCCACTGCTTCCCTGAGACCCAGTTCATAGCGGTGACTGCTTATCAGAACGAGGAGATCACAGCTCTTAAAATTAAGTACAATCCATTTGCAAAAGCTTTCCTTGATGCAAAGGAAAGAAGTGATCACAAAGAGATGATGGAGGAACCCGGAGACAGCCAGCAACCTGGGTACTCCCAATGGGGGTGGCTTCTTCCTGGAACCAGCACCCTGTGTCCACCTGCAAATCCTCATCCTCAGTTTGGAGGTGCCCTCTCCCTCCCCTCCACGCACAGCTGTGACAGGTACCCAACCCTGAGGAGCCACCGGTCCTCACCCTACCCCAGCCCCTATGCTCATCGGAACAATTCTCCAACCTATTCTGACAACTCACCTGCATGTTTATCCATGCTGCAATCCCATGACAATTG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... T(6862) , T(6862)

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Zewen Kelvin Tuong et al.
PloS one, 11(1), e0147179-e0147179 (2016-01-27)
Nuclear hormone receptors have important roles in the regulation of metabolic and inflammatory pathways. The retinoid-related orphan receptor alpha (Rorα)-deficient staggerer (sg/sg) mice display several phenotypes indicative of aberrant lipid metabolism, including dyslipidemia, and increased susceptibility to atherosclerosis. In this
Y J Yang et al.
Cell death & disease, 6, e2025-e2025 (2015-12-18)
Taurine, which is found at high concentration in the heart, exerts several protective actions on myocardium. Physically, the high level of taurine in heart is maintained by a taurine transporter (TauT), the expression of which is suppressed under ischemic insult.
Yi-Hui Yu et al.
International journal of clinical and experimental pathology, 8(3), 2582-2589 (2015-06-06)
The aim of this study was to determine whether long non-coding RNA PVT1 can participate in the regulation of cardiac hypertrophy. A C57BL/6 mouse cardiac hypertrophic model was established using transverse aortic constriction (TAC). The animals subjected to sham operation
Alexander Michael Tabony et al.
Skeletal muscle, 4, 20-20 (2015-01-28)
Circulating angiotensin II (AngII) is elevated in congestive heart failure (CHF), and leads to skeletal muscle wasting, which is strongly associated with poor patient outcomes. We previously found that AngII upregulates protein phosphatase 2C-alpha (PP2Cα) and dephosphorylates AMP-activated protein kinase
Jiaxuan Chen et al.
Journal of tissue engineering and regenerative medicine, 10(1), 40-51 (2013-06-21)
1α,25-Dihydroxyvitamin D3 [1α,25(OH)2D3] and bone morphogenetic protein-2 (BMP2) are both used to stimulate osteoblastic differentiation. 1α,25(OH)2D3 regulates osteoblasts through classical steroid hormone receptor mechanisms and through rapid responses that are mediated by two receptors, the traditional vitamin D receptor (VDR)

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.