Direkt zum Inhalt
Merck

EHU141171

Sigma-Aldrich

MISSION® esiRNA

targeting human ATPIF1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CGTGAGGACCATGCAAGCCCGAGGCTTCGGCTCGGATCAGTCCGAGAATGTCGACCGGGGCGCGGGCTCCATCCGGGAAGCCGGTGGGGCCTTCGGAAAGAGAGAGCAGGCTGAAGAGGAACGATATTTCCGACATTACAGGTTATGCTTTGAGATCTCTTTGGGGTGAAGGATTGAAATTAAACCCTGAGCCACCGTGTCCTTGTAGAGCACAGAGTAGAGAACAACTGGCAGCTTTGAAAAAACACCATGAAGAAGAAATCGTTCATCATAAGAAGGAGATTGAGCGTCTGCAGAAAGAAATTGAGCGCCATAAGCAGAAGATCAAAATGCTAAAACATGATGATTAAGTGCACACCGTGTGCCATAGAATGGCACATGTCATTGCCCACTTCTGTGT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Kévin Hardonnière et al.
Scientific reports, 7(1), 195-195 (2017-03-17)
Most tumors undergo metabolic reprogramming towards glycolysis, the so-called Warburg effect, to support growth and survival. Overexpression of IF1, the physiological inhibitor of the F0F1ATPase, has been related to this phenomenon and appears to be a relevant marker in cancer.
Yuyu Zhang et al.
Frontiers in immunology, 12, 590447-590447 (2021-03-16)
MicroRNAs (miRNAs) have been discovered to dictate the development of various tumors. However, studies on the roles of miRNAs in the progression of gastric cancer (GC) are still lacking. Herein, by analyzing GC cell lines and patients samples, we observed
Pamela Maher
Antioxidants (Basel, Switzerland), 10(1) (2021-01-21)
Although the hallmarks of Alzheimer's disease (AD) are amyloid beta plaques and neurofibrillary tangles, there is growing evidence that neuroinflammation, mitochondrial dysfunction and oxidative stress play important roles in disease development and progression. A major risk factor for the development
Yun Chen et al.
PloS one, 9(5), e98483-e98483 (2014-05-24)
Previous studies showed that prostacyclin inhibited fibrosis. However, both receptors of prostacyclin, prostacyclin receptor (IP) and peroxisome proliferator-activated receptor (PPAR), are abundant in cardiac fibroblasts. Here we investigated which receptor was vital in the anti-fibrosis effect of prostacyclin. In addition
Fabrice Ivanes et al.
British journal of pharmacology, 171(18), 4193-4206 (2014-03-20)
Ischaemia compromises mitochondrial respiration. Consequently, the mitochondrial F1 Fo-ATPsynthase reverses and acts as a proton-pumping ATPase, so maintaining the mitochondrial membrane potential (ΔΨm ), while accelerating ATP depletion and cell death. Here we have looked for a molecule that can

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.