Direkt zum Inhalt
Merck

EHU136431

Sigma-Aldrich

MISSION® esiRNA

targeting human NRGN

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CAAAATCCAGGCGAGTTTTCGGGGCCACATGGCGCGGAAGAAGATAAAGAGCGGAGAGCGCGGCCGGAAGGGCCCGGGCCCTGGGGGGCCTGGCGGAGCTGGGGTGGCCCGGGGAGGCGCGGGCGGCGGCCCCAGCGGAGACTAGGCCAGAAGAACTGAGCATTTTCAAAGTTCCCGAGGAGAGATGGATGCCGCGTCCCCTTCGCAGCGACGAGACTTCCCTGCCGTGTTTGTGACCCCCTCCTGCCCAGCAACCTGCCAGCTACAGGAGCCCCCTGCGTCCCAGAGACTCCCTCACCCAGGCAGGCTCCGTCGCGGAGTCGCTGAGTCCGTGCCCTTTTAGTTAGTTCTGCAGTCTAGTATGGTCCCCATTTGCCCTTCCACTCCACCCCACCCTAAACCATGCGCTCCCAATCTTCCTTCTTTTGCTTCTCGC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Dokumente section.

Wenn Sie Hilfe benötigen, wenden Sie sich bitte an Kundensupport

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Colin Watanabe et al.
RNA biology, 13(1), 25-33 (2016-01-21)
Incorporating miRNA-like features into vector-based hairpin scaffolds has been shown to augment small RNA processing and RNAi efficiency. Therefore, defining an optimal, native hairpin context may obviate a need for hairpin-specific targeting design schemes, which confound the movement of functional
Mariana Marin et al.
Viruses, 11(2) (2019-01-30)
The HIV-1 entry pathway into permissive cells has been a subject of debate. Accumulating evidence, including our previous single virus tracking results, suggests that HIV-1 can enter different cell types via endocytosis and CD4/coreceptor-dependent fusion with endosomes. However, recent studies
Mirko Theis et al.
Journal of biomolecular screening, 20(8), 1018-1026 (2015-04-26)
Broad sequencing enterprises such as the FANTOM or ENCODE projects have substantially extended our knowledge of the human transcriptome. They have revealed that a large portion of genomic DNA is actively transcribed and have identified a plethora of novel transcripts.
Deanna M Santer et al.
Journal of immunological methods, 445, 15-22 (2017-03-10)
Type III interferons (IFN-lambdas) are important antiviral cytokines that also modulate immune responses acting through a unique IFN-λR1/IL-10R2 heterodimeric receptor. Conflicting data has been reported for which cells express the IFN-λR1 subunit and directly respond to IFN-λs. In this study
Isabel Weinheimer et al.
The Journal of general virology, 95(Pt 2), 486-495 (2013-11-05)
Sweet potato chlorotic stunt virus (SPCSV; genus Crinivirus, family Closteroviridae) causes heavy yield losses in sweet potato plants co-infected with other viruses. The dsRNA-specific class 1 RNase III-like endoribonuclease (RNase3) encoded by SPCSV suppresses post-transcriptional gene silencing and eliminates antiviral

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.