Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU120451

Sigma-Aldrich

MISSION® esiRNA

targeting human RAPGEF3

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GCTCTTTGAACCACACAGCAAGGCAGGGACCGTGTTGTTCAGCCAGGGGGACAAGGGCACTTCGTGGTACATTATCTGGAAGGGATCTGTCAACGTGGTGACCCATGGCAAGGGGCTGGTGACCACCCTGCATGAGGGAGATGATTTTGGACAGCTGGCTCTGGTGAATGATGCACCCCGGGCAGCCACCATCATCCTGCGAGAAGACAACTGTCATTTCCTGCGTGTGGACAAGCAGGACTTCAACCGTATCATCAAGGATGTGGAGGCAAAGACCATGCGGCTGGAAGAACATGGCAAAGTGGTGCTGGTGCTGGAGAGAGCCTCTCAGGGCGCCGGCCCTTCCCGACCCCCAACCCCAGGCAGGAACCGGTATACAGTGATGTCTGGCACCCCAGAGAAGATCCTAGAGCTTCTGTTGGAGGCCATGGGACCAGATTCCAGTGCTCATGACCCAACAGAGACATTCCTCAGCGACTTCCTC

Ensembl | Human Hinterlegungsnummer

ENSG00000079337

NCBI-Hinterlegungsnummer

NM_001098531

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... RAPGEF3(10411) , RAPGEF3(10411)

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Li Liu et al.
Molecular vision, 23, 1-7 (2017-02-18)
Increased inflammatory mediator levels are reported in diabetic retinopathy. We previously reported that β-adrenergic receptor agonists reduced inflammatory mediators in the diabetic retina; however, these agents cannot be given systemically. Here, we investigated whether Epac1 is key to the protective
Jolanta Wiejak et al.
Biochimica et biophysica acta. Molecular cell research, 1866(2), 264-276 (2018-11-12)
Exchange protein activated by cyclic AMP (EPAC1) suppresses multiple inflammatory actions in vascular endothelial cells (VECs), partly due to its ability to induce expression of the suppressor of cytokine signalling 3 (SOCS3) gene, the protein product of which inhibits interleukin
Kazuya Kusama et al.
Reproduction, fertility, and development (2018-05-08)
Protein kinase A (PKA) signalling accompanies elevated intracellular cAMP levels during endometrial stromal cell (ESC) decidualisation. Exchange protein directly activated by cAMP (EPAC), an alternate mediator of cAMP signalling, promotes PKA analogue-induced decidualisation; however, the precise mechanism by which EPAC
Jaspal Garg et al.
Oncotarget, 8(27), 44732-44748 (2017-05-18)
Chronic stress has been associated with the progression of cancer and antagonists for β-adrenoceptors (βAR) are regarded as therapeutic option. As they are also used to treat hemangiomas as well as retinopathy of prematurity, a role of endothelial β2AR in
Jongbo Lee et al.
PLoS biology, 18(12), e3001002-e3001002 (2020-12-29)
Nucleocytoplasmic transport (NCT) defects have been implicated in neurodegenerative diseases such as C9ORF72-associated amyotrophic lateral sclerosis and frontotemporal dementia (C9-ALS/FTD). Here, we identify a neuroprotective pathway of like-Sm protein 12 (LSM12) and exchange protein directly activated by cyclic AMP 1
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.