Direkt zum Inhalt
Merck

EHU113521

Sigma-Aldrich

MISSION® esiRNA

targeting human HSPD1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TCTGCAAACGGAGACAAAGAAATTGGCAATATCATCTCTGATGCAATGAAAAAAGTTGGAAGAAAGGGTGTCATCACAGTAAAGGCAAGTGATGGAAAAACACTGAATGATGAATTAGAAATTATTGAAGGCATGAAGTTTGATCGAGGCTATATTTCTCCATACTTTATTAATACATCAAAAGGTCAGAAATGTGAATTCCAGGATGCCTATGTTCTGTTGAGTGAAAAGAAAATTTCTAGTATCCAGTCCATTGTACCTGCTCTTGAAATTGCCAATGCTCACCGTAAGCCTTTGGTCATAATCGCTGAAGATGTTGATGGAGAAGCTCTAAGTACACTCGTCTTGAATAGGCTAAAGGTTGGTCTTCAGGTTGTGGCAGTCAAGGCTCCAGGGTTTGGTGACAATAGAAAGAACCAGCTTAAAGATATGGCTATTGCTACTGGTGGTGCAGTGTTTGGAGAAG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Bor-Hwang Kang et al.
Scientific reports, 9(1), 8932-8932 (2019-06-22)
Buccal mucosa squamous cell carcinoma (BMSCC) is one of major subsites of oral cancer and is associated with a high rate of metastasis and poor prognosis. Heat shock proteins (HSPs) act as potential prognostic biomarkers in many cancer types. However
Justin F Deniset et al.
Cellular signalling, 47, 44-51 (2018-03-30)
Heat shock protein 60 (Hsp60) is a mediator of stress-induced vascular smooth muscle cell (VSMC) proliferation. This study will determine, first, if the mitochondrial or cytoplasmic localization of Hsp60 is critical to VSMC proliferation and, second, the mechanism of Hsp60
Sharmin Afroz et al.
Virus research, 261, 37-49 (2018-12-15)
The UL47 gene product, VP8, is a major tegument protein of BoHV-1. While VP8 is not essential for virus replication in cell culture, a UL47-deleted virus exhibits a smaller tegument structure and is avirulent in cattle. To obtain pure VP8
Shalini Swaroop et al.
Journal of neuroinflammation, 15(1), 177-177 (2018-06-11)
Interleukin-1β (IL-1β) is one of the most important cytokine secreted by activated microglia as it orchestrates the vicious cycle of inflammation by inducing the expression of various other pro-inflammatory cytokines along with its own production. Microglia-mediated IL-1β production is a
Hiroyuki Hosokawa et al.
The Journal of biological chemistry, 290(21), 13095-13103 (2015-04-12)
Gata3 acts as a master regulator for T helper 2 (Th2) cell differentiation by inducing chromatin remodeling of the Th2 cytokine loci, accelerating Th2 cell proliferation, and repressing Th1 cell differentiation. Gata3 also directly transactivates the interleukin-5 (Il5) gene via

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.