Direkt zum Inhalt
Merck
Alle Fotos(1)

Wichtige Dokumente

EHU111231

Sigma-Aldrich

MISSION® esiRNA

targeting human ACTA2

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ACCCACAATGTCCCCATCTATGAGGGCTATGCCTTGCCCCATGCCATCATGCGTCTGGATCTGGCTGGCCGAGATCTCACTGACTACCTCATGAAGATCCTGACTGAGCGTGGCTATTCCTTCGTTACTACTGCTGAGCGTGAGATTGTCCGGGACATCAAGGAGAAACTGTGTTATGTAGCTCTGGACTTTGAAAATGAGATGGCCACTGCCGCATCCTCATCCTCCCTTGAGAAGAGTTACGAGTTGCCTGATGGGCAAGTGATCACCATCGGAAATGAACGTTTCCGCTGCCCAGAGACCCTGTTCCAGCCATCCTTCATCGGGATGGAGTCTGCTGGCATCCATGAAACCACCTACAACAGCATCATGAAGTGTGATATTGACATCAGGAAGGACCTCTATGCTAACAATGTCCTATCAGGGGGCACCACTATGTACCCTGGCATTGCC

Ensembl | Human Hinterlegungsnummer

ENSG00000107796

NCBI-Hinterlegungsnummer

NM_001613

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... ACTA2(59) , ACTA2(59)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Ling Li et al.
BMC microbiology, 8, 26-26 (2008-02-08)
Porphyromonas gingivalis is associated with periodontal disease and invades different cell types including epithelial, endothelial and smooth muscle cells. In addition to P. gingivalis DNA, we have previously identified live invasive bacteria in atheromatous tissue. However, the mechanism of persistence
Melissa A Kinney et al.
Scientific reports, 4, 4290-4290 (2014-03-07)
Stem cell fate and function are dynamically modulated by the interdependent relationships between biochemical and biophysical signals constituting the local 3D microenvironment. While approaches to recapitulate the stem cell niche have been explored for directing stem cell differentiation, a quantitative
Charlotte Thålin et al.
Thrombosis research, 139, 56-64 (2016-02-27)
Large elevations of high sensitive Troponin T (hsTnT) in ischemic stroke patients is associated with a poor outcome. In a pilot study we found a high prevalence of malignancies among these patients. Since neutrophil extracellular traps (NETs) have been linked
Xiao-Yang Wang et al.
Molecular cancer, 9, 221-221 (2010-08-24)
Musashi1 (Msi1) is a conserved RNA-binding protein that regulates the Notch and Wnt pathways, and serves as a stem cell marker in the breast and other tissues. It is unknown how Msi1 relates to other breast cancer markers, whether it
Omar Khalid et al.
PloS one, 11(3), e0150850-e0150850 (2016-03-18)
Cardiovascular disease, a progressive manifestation of α-L-iduronidase deficiency or mucopolysaccharidosis type I, continues in patients both untreated and treated with hematopoietic stem cell transplantation or intravenous enzyme replacement. Few studies have examined the effects of α-L-iduronidase deficiency and subsequent glycosaminoglycan
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.