Direkt zum Inhalt
Merck

EHU109701

Sigma-Aldrich

MISSION® esiRNA

targeting human HSP90B1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AAGGGTGTGGTGGACTCAGATGATCTCCCCTTGAATGTTTCCCGCGAGACTCTTCAGCAACATAAACTGCTTAAGGTGATTAGGAAGAAGCTTGTTCGTAAAACGCTGGACATGATCAAGAAGATTGCTGATGATAAATACAATGATACTTTTTGGAAAGAATTTGGTACCAACATCAAGCTTGGTGTGATTGAAGACCACTCGAATCGAACACGTCTTGCTAAACTTCTTAGGTTCCAGTCTTCTCATCATCCAACTGACATTACTAGCCTAGACCAGTATGTGGAAAGAATGAAGGAAAAACAAGACAAAATCTACTTCATGGCTGGGTCCAGCAGAAAAGAGGCTGAATCTTCTCCATTTGTTGAGCGACTTCTGAAAAAGGGCTATGAAGTTATTTACCTCACAGAACCTGTGGATGAATACTGTATTCAGGCCCTTCCCGAATTTGATGGGAAGAGGTTCCAG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Pedro Buc Calderon et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 105, 115-120 (2018-06-01)
Grp94 plays an essential role in protein assembly. We previously suggested that Grp94 overexpression is involved in tumor aggressiveness. However, the underlying mechanisms remain unknown. Since many tumors display high Grp94 levels, we investigated the effects of tumor microenvironment on
Qun Wei et al.
Biochemical and biophysical research communications, 511(1), 92-98 (2019-02-17)
Vascular endothelial cell (VEC) apoptosis takes part in the development of various cardiovascular diseases. Heat shock protein 90 (HSP90) regulates apoptosis through various apoptosis associated client proteins. In previous study, we identified a novel HSP90 inhibitor HCP1 induced apoptosis in
Naiara Santana-Codina et al.
International journal of molecular sciences, 20(16) (2019-08-10)
Metabolic adaptation may happen in response to the pressure exerted by the microenvironment and is a key step in survival of metastatic cells. Brain metastasis occurs as a consequence of the systemic dissemination of tumor cells, a fact that correlates
Sha She et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 48(2), 741-752 (2018-07-20)
C reactive protein (CRP) levels are elevated in many diseases, including malignant tumors and cardiovascular disorders. In this study, the protein interaction network for CRP was evaluated to determine the importance of CRP and its interacting proteins in the molecular
Lipeng Xiong et al.
Journal of proteomics, 182, 34-44 (2018-05-08)
A Disintegrin And Metalloproteinase 12 (ADAM12) is highly expressed in multiple cancers such as breast and cervical cancers and its high expression reduces the overall patient survival rate. ADAM12 has two major splicing variants, the long membrane-anchored form ADAM12L and

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.