Direkt zum Inhalt
Merck
Alle Fotos(1)

Wichtige Dokumente

EHU108531

Sigma-Aldrich

MISSION® esiRNA

targeting human LDHA

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

100

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ACGTCAGCAAGAGGGAGAAAGCCGTCTTAATTTGGTCCAGCGTAACGTGAACATCTTTAAATTCATCATTCCTAATGTTGTAAAATACAGCCCGAACTGCAAGTTGCTTATTGTTTCAAATCCAGTGGATATCTTGACCTACGTGGCTTGGAAGATAAGTGGTTTTCCCAAAAACCGTGTTATTGGAAGCGGTTGCAATCTGGATTCAGCCCGATTCCGTTACCTAATGGGGGAAAGGCTGGGAGTTCACCCATTAAGCTGTCATGGGTGGGTCCTTGGGGAACATGGAGATTCCAGTGTGCCTGTATGGAGTGGAATGAATGTTGCTGGTGTCTCTCTGAAGACTCTGCACCCAGATTTAGGGACTGATAAAGATAAGGAACAGTGGAAAGAGGTTCACAAGCAGGTGGTTGAG

Ensembl | Human Hinterlegungsnummer

ENSG00000134333

NCBI-Hinterlegungsnummer

NM_005566

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... LDHA(3939) , LDHA(3939)

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Michael Koukourakis et al.
Biochemical and biophysical research communications, 491(4), 932-938 (2017-08-02)
Up-regulation of lactate dehydrogenase LDHA, is a frequent event in human malignancies and relate to poor postoperative outcome. In the current study we examined the hypothesis that LDHA and anaerobic glycolysis, may contribute to the resistance of glioblastoma to radiotherapy
Michael I Koukourakis et al.
Laboratory investigation; a journal of technical methods and pathology, 97(11), 1321-1331 (2017-08-29)
Cooperation of cancer cells with stromal cells, such as cancer-associated fibroblasts (CAFs), has been revealed as a mechanism sustaining cancer cell survival and growth. In the current study, we focus on the metabolic interactions of MRC5 lung fibroblasts with lung
Weiyou Zhu et al.
American journal of translational research, 10(7), 2055-2067 (2018-08-11)
The use of human epidermal growth factor receptor-2 (HER2) as a biomarker for gastric cancer (GC) has greatly helped some patients receive benefit from HER2-targeted therapy. However, the correlation between HER2 and other biochemical markers is unclear. The aim of
Woo-Cheol Sim et al.
Cell biology and toxicology, 35(5), 457-470 (2019-02-06)
Silent information regulator 1 (SIRT1) is a nicotinamide adenine dinucleotide (NAD+)-dependent deacetylase, and the function is linked to cellular metabolism including mitochondrial biogenesis. Hepatic L-serine concentration is decreased significantly in fatty liver disease. We reported that the supplementation of the
Rosa Ferriero et al.
Journal of hepatology, 69(2), 325-335 (2018-03-28)
Acute liver failure is a rapidly progressive deterioration of hepatic function resulting in high mortality and morbidity. Metabolic enzymes can translocate to the nucleus to regulate histone acetylation and gene expression. Levels and activities of pyruvate dehydrogenase complex (PDHC) and
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.