Direkt zum Inhalt
Merck

EHU106991

Sigma-Aldrich

MISSION® esiRNA

targeting human UQCRFS1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GGAAATTGAGCAGGAAGCTGCAGTTGAATTATCACAGTTGAGGGACCCACAGCATGATCTAGATCGAGTAAAGAAACCTGAATGGGTTATCCTGATAGGTGTTTGCACTCATCTTGGCTGTGTACCCATTGCAAATGCAGGAGATTTTGGTGGTTATTACTGCCCTTGCCATGGGTCACACTATGATGCATCTGGCAGGATCAGATTGGGTCCTGCTCCTCTCAACCTTGAAGTCCCCACGTATGAGTTCACCAGTGACGATATGGTGATTGTTGGTTAAGAGACTTGGACTCAAGTCATAGGCTTCTTTCAGTCTTTATGTCACCTCAGGAGACTTATTTGAGAGGAAGCCTTCTGTACTTGAAGTTGATTTGAAATATGTAAGAATTGATGATGTATTTGCAAACATTAATGTGAAATAAATTGAATTTAATGTTGAATACTTTCAGGCATTCACTTAATAAAGACACTGTTAAGCACTGTTATGCTCAGTCATACACGCGAAA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Leider sind derzeit keine COAs für dieses Produkt online verfügbar.

Wenn Sie Hilfe benötigen, wenden Sie sich bitte an Kundensupport

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Zhao Yang et al.
Antioxidants & redox signaling, 32(7), 447-462 (2019-08-29)
Aims: It is known that mitochondrial reactive oxygen species generation ([ROS]m) causes the release of Ca2+via ryanodine receptor-2 (RyR2)
Lin Mei et al.
Nature communications, 11(1), 3527-3527 (2020-07-17)
Ca2+ signaling in pulmonary arterial smooth muscle cells (PASMCs) plays an important role in pulmonary hypertension (PH). However, the underlying specific ion channel mechanisms remain largely unknown. Here, we report ryanodine receptor (RyR) channel activity and Ca2+ release both are
Yoshiko Kaku et al.
Cellular signalling, 27(9), 1713-1719 (2015-05-26)
The present study investigated 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine (DAPE)-induced cell death in malignant pleural mesothelioma (MPM) cells. DAPE reduced cell viability in NCI-H28, NCI-H2052, NCI-H2452, and MSTO-211H MPM cell lines in a concentration (1-100μM)-dependent manner. In the flow cytometry using propidium iodide (PI)
W He et al.
Oncogene, 33(23), 3004-3013 (2013-07-09)
Killing cancer cells through the induction of apoptosis is one of the main mechanisms of chemotherapy. However, numerous cancer cells have primary or acquired apoptosis resistance, resulting in chemoresistance. In this study, using a novel chalcone derivative chalcone-24 (Chal-24), we
H Schoeneberger et al.
Oncogene, 34(31), 4032-4043 (2014-11-11)
Evasion of apoptosis in pediatric acute lymphoblastic leukemia (ALL) is linked to aberrant expression of inhibitor of apoptosis (IAP) proteins and dysregulated redox homeostasis, rendering leukemic cells vulnerable to redox-targeting therapies. Here we discover that inhibition of antioxidant defenses via

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.