Direkt zum Inhalt
Merck

EHU106031

Sigma-Aldrich

MISSION® esiRNA

targeting human CDC20

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CTACAGCCAAAAGGCCACTCCTGGCTCCAGCCGGAAGACCTGCCGTTACATTCCTTCCCTGCCAGACCGTATCCTGGATGCGCCTGAAATCCGAAATGACTATTACCTGAACCTTGTGGATTGGAGTTCTGGGAATGTACTGGCCGTGGCACTGGACAACAGTGTGTACCTGTGGAGTGCAAGCTCTGGTGACATCCTGCAGCTTTTGCAAATGGAGCAGCCTGGGGAATATATATCCTCTGTGGCCTGGATCAAAGAGGGCAACTACTTGGCTGTGGGCACCAGCAGTGCTGAGGTGCAGCTATGGGATGTGCAGCAGCAGAAACGGCTTCGAAATATGACCAGTCACTCTGCCCGAGTGGGCTCCCTAAGCTGGAACAGCTATATCCTGTCCAGTGGTTCACGTTCTGGCCACATCCACCACCATGATGT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Yuan Gao et al.
Aging, 13(2), 2668-2680 (2021-01-08)
The molecular mechanism of osteosarcoma (OS) pathogenesis is poorly understood. The Notch signaling pathway has been shown to be critically involved in tumorigenesis, including OS. Therefore, we explored the molecular mechanism by which the Notch-1 signaling pathway is involved in
Shujie Cheng et al.
International journal of oncology, 54(6), 2250-2256 (2019-05-14)
Aberrant expression of cell division cycle 20 (CDC20) is associated with malignant progression and poor prognosis in various types of cancer. The development of specific CDC20 inhibitors may be a novel strategy for the treatment of cancer with elevated expression of
Jia Li et al.
International journal of oncology, 45(4), 1547-1555 (2014-07-30)
Cell division cycle 20 (CDC20) encodes a regulatory protein interacting with the anaphase-promoting complex/cyclosome (APC/C) in the cell cycle and plays important roles in tumorigenesis and progression of multiple tumors. The present study aimed to investigate the clinical significance of
N Bah et al.
Cell death & disease, 5, e1291-e1291 (2014-06-13)
Antimitotic agents such as microtubule inhibitors (paclitaxel) are widely used in cancer therapy while new agents blocking mitosis onset are currently in development. All these agents impose a prolonged mitotic arrest in cancer cells that relies on sustained activation of
Karine Boulay et al.
Nucleic acids research, 42(12), 7867-7883 (2014-06-08)
Staufen1 (Stau1) is a ribonucleic acid (RNA)-binding protein involved in the post-transcriptional regulation of gene expression. Recent studies indicate that Stau1-bound messenger RNAs (mRNAs) mainly code for proteins involved in transcription and cell cycle control. Consistently, we report here that

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.