Direkt zum Inhalt
Merck
Alle Fotos(1)

Wichtige Dokumente

EHU096141

Sigma-Aldrich

MISSION® esiRNA

targeting human MAX

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

100

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GACAGATTCGCAGCACAGAGTCGCTGGCATGTTTCACTCCTGCTTCTCTCAGCCAGCTGTTTAAGCCTGCGGCGCCAGCCTCACGGAGGGCCGTGTGACACTCTCGTGGTATGTATGGGAGATGGCAGCAGTGAAGCAGCAGCCACCAGGGAGTGGCCATTTGGGGTTGGGACAGGGAGGGTGTTTTGGGTGGCATAGAGGTTTTGTATTGAGGGCCAGTGATGATGTTTTGATATTTATTTCCTGCTACTTAAATTTGAATCTGAGTGAATTGTACCTATTTCTGATGATGTCGGTCTTGC

Ensembl | Human Hinterlegungsnummer

ENSG00000125952

NCBI-Hinterlegungsnummer

NM_197957

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... MAX(4149) , MAX(4149)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Tsz-Lun Yeung et al.
Oncotarget, 8(10), 16951-16963 (2017-02-16)
Transcription factors are master switches for various biochemical pathways. However, transcription factors involved in the pathogenesis of ovarian cancer have yet to be explored thoroughly. Therefore, in the present study, we assessed the prognostic value of the transcription factor E74-like
Olivier Godfroy et al.
The Plant cell, 29(12), 3102-3122 (2017-12-07)
Brown algae are one of the most developmentally complex groups within the eukaryotes. As in many land plants and animals, their main body axis is established early in development, when the initial cell gives rise to two daughter cells that
Mi-Ok Lee et al.
Biochemical and biophysical research communications, 520(2), 406-412 (2019-10-15)
Selenium (Se) plays a vital role in reactive oxygen species (ROS) homeostasis and redox regulation in intracellular signaling via selenocysteine (Sec), known as the 21st proteinogenic amino acid, but its specific biological functions in development and disease remain undiscovered. In
Antonella Caivano et al.
Oncotarget, 8(21), 34298-34309 (2017-04-19)
This study investigates the role of ephrin receptor A3 (EphA3) in the angiogenesis of Multiple Myeloma (MM) and the effects of a selective target of EphA3 by a specific monoclonal antibody on primary bone marrow endothelial cells (ECs) of MM
Farah Sharieh et al.
Alcoholism, clinical and experimental research, 44(6), 1204-1213 (2020-04-19)
During bone fracture repair, resident mesenchymal stem cells (MSCs) differentiate into chondrocytes, to form a cartilaginous fracture callus, and osteoblasts, to ossify the collagen matrix. Our laboratory previously reported that alcohol administration led to decreased cartilage formation within the fracture
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.