Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU094691

Sigma-Aldrich

MISSION® esiRNA

targeting human CD44

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TTAAAGGGATTCCCATCATTGGAATCTTATCACCAGATAGGCAAGTTTATGACCAAACAAGAGAGTACTGGCTTTATCCTCTAACCTCATATTTTCTCCCACTTGGCAAGTCCTTTGTGGCATTTATTCATCAGTCAGGGTGTCCGATTGGTCCTAGAACTTCCAAAGGCTGCTTGTCATAGAAGCCATTGCATCTATAAAGCAACGGCTCCTGTTAAATGGTATCTCCTTTCTGAGGCTCCTACTAAAAGTCATTTGTTACCTAAACTTATGTGCTTAACAGGCAATGCTTCTCAGACCACAAAGCAGAAAGAAGAAGAAAAGCTCCTGACTAAATCAGGGCTGGGCTT

Ensembl | Human Hinterlegungsnummer

ENSG00000026508

NCBI-Hinterlegungsnummer

NM_001001391

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... CD44(960) , CD44(960)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Zenghui Fang et al.
Experimental cell research, 382(1), 111462-111462 (2019-06-14)
Scaffolding adaptor Gab2 is overexpressed in a subset of high-grade ovarian cancer. Our published work shows that Gab2 via PI3K enhances migratory behaviors and epithelial to mesenchymal transition (EMT) features of ovarian cancer cells in vitro. However, it is still
Doohyung Lee et al.
Hepatology (Baltimore, Md.), 61(6), 1978-1997 (2015-01-30)
Tumor metastasis involves circulating and tumor-initiating capacities of metastatic cancer cells. Epithelial-mesenchymal transition (EMT) is related to self-renewal capacity and circulating tumor cell (CTC) characteristics for tumor metastasis. Although tumor metastasis is a life-threatening, complicated process that occurs through circulation
Anna-Karin Ekman et al.
The Journal of investigative dermatology, 139(7), 1564-1573 (2019-01-27)
Psoriasis is an inflammatory skin disorder characterized by the hyperproliferation of basal epidermal cells. It is regarded as T-cell mediated, but the role of keratinocytes (KCs) in the disease pathogenesis has reemerged, with genetic studies identifying KC-associated genes. We applied
Gan Yu et al.
The Journal of urology, 192(4), 1229-1237 (2014-05-29)
We investigated the potential functions of miR-34a in CD44 transcriptional complexes in renal cell carcinoma. We detected miR-34a expression by quantitative real-time polymerase chain reaction. Oligonucleotides were used to over express miR-34a. Cell proliferation and xenograft assays, colony formation and
Jingying Zheng et al.
Theranostics, 7(5), 1373-1388 (2017-04-25)
CD44 and EpCAM play crucial roles in intraperitoneal ovarian cancer development. In this study, we developed an RNA-based bispecific CD44-EpCAM aptamer that is capable of blocking CD44 and EpCAM simultaneously by fusing single CD44 and EpCAM aptamers with a double
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.