Direkt zum Inhalt
Merck

EHU094591

Sigma-Aldrich

MISSION® esiRNA

targeting human MYB

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GGGCAGTAGAGCTTGGACAGAAAGAAAAGAAACTTGGTGTTAGGTAATTGACTATGCACTAGTATTTCAGACTTTTTAATTTTATATATATATACATTTTTTTTCCTTCTGCAATACATTTGAAAACTTGTTTGGGAGACTCTGCATTTTTTATTGTGGTTTTTTTGTTATTGTTGGTTTATACAAGCATGCGTTGCACTTCTTTTTTGGGAGATGTGTGTTGTTGATGTTCTATGTTTTGTTTTGAGTGTAGCCTGACTGTTTTATAATTTGGGAGTTCTGCATTTGATCCGCATCCCCTGTGGTTTCTAAGTGTATGGTCTCAGAACTGTTGCATGGATCCTGTGTT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Xuefeng Li et al.
Nature microbiology, 1(10), 16132-16132 (2016-09-28)
MicroRNAs (miRNAs) play critical roles in various biological processes, including cell proliferation, development and host defence. However, the molecular mechanism for miRNAs in regulating bacterial-induced inflammation remains largely unclear. Here, we report that miR-301b augments pro-inflammatory response during pulmonary infection
Yue Wang et al.
Cancer letters, 385, 234-242 (2016-10-25)
The oncoprotein Yes-associated protein (YAP) in Hippo pathway plays crucial roles in the development of cancer. However, the mechanism of YAP regulation in cancer remains poorly understood. Here, we supposed that the oncoprotein hepatitis B X-interacting protein (HBXIP) might be
Tian Lan et al.
Cancer research, 79(13), 3220-3234 (2019-05-19)
Understanding the roles of noncoding RNAs (ncRNA) in tumorigenesis and metastasis would establish novel avenues to identify diagnostic and therapeutic targets. Here, we aimed to identify hepatocellular carcinoma (HCC)-specific ncRNA and to investigate their roles in hepatocarcinogenesis and metastasis. RNA-seq
Neil Rajan et al.
The Journal of pathology, 239(2), 197-205 (2016-03-13)
Cutaneous cylindroma is an adnexal tumour with apocrine differentiation. A predisposition to multiple cylindromas is seen in patients with Brooke-Spiegler syndrome, who carry germline mutations in the tumour suppressor gene CYLD. Previous studies of inherited cylindromas have highlighted the frequent
Sapana Jalnapurkar et al.
Stem cell research & therapy, 7(1), 171-171 (2016-11-24)
The success of hematopoietic stem cell (HSC) transplantation is dependent on the quality of the donor HSCs. Some sources of HSCs display reduced engraftment efficiency either because of inadequate number (e.g., fetal liver and cord blood), or age-related dysfunction (e.g.

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.