Direkt zum Inhalt
Merck

EHU094321

Sigma-Aldrich

MISSION® esiRNA

targeting human WNK1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ACCACTTCATTCCCAAGCACAGCTTCACAGCTGTGCATTCAGCTTAGCAGCAGTACTTCTACTCCTACTTTAGCTGAAACCGTGGTAGTTAGCGCACACTCACTAGATAAGACATCTCATAGCAGTACAACTGGATTGGCTTTCTCCCTCTCTGCACCATCTTCCTCTTCCTCTCCTGGAGCAGGAGTGTCTAGTTATATTTCTCAGCCTGGTGGGCTGCATCCTTTGGTCATTCCATCAGTGATAGCTTCTACTCCTATTCTTCCCCAAGCAGCAGGACCTACTTCTACACCTTTATTACCCCAAGTACCTAGTATCCCACCCTTGGTACAGCCTGTTGCCAATGTGCCTGCTGTACAGCAGACACTAATTCATAGTCAGCCTCAACCAGCTTTGCTTCCCAACCAGCCCCATACTCATTG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Sukanya Shyamasundar et al.
International journal of oncology, 49(6), 2629-2636 (2016-11-15)
Despite advances in treatment, the highly metastatic nature of breast tumors has given rise to the urgent need for development of novel therapeutic and prognostic markers. miR-93 is known to regulate the epithelial to mesenchymal transition process and to influence
Hui Dong et al.
Journal of cellular physiology, 235(10), 6548-6562 (2020-02-19)
Long noncoding RNAs (lncRNAs) have been recognized as cancer-associated biological molecules, favoring hepatocellular carcinoma (HCC) progression. This study was conducted to elucidate the effects lncRNA lymphoid enhancer-binding Factor 1 antisense RNA (LEF1-AS1) on the pathological development of HCC, along with
Jen-Yu Hung et al.
Oncotarget, 8(38), 63691-63702 (2017-10-04)
The extracellular matrix is a component of physiological microenvironment and a regulator of cellular processes such as migration and proliferation. Secreted Protein Acidic and Rich in Cysteine (SPARC/osteonectin) is an extracellular matrix-associated glycoprotein involved in the regulation of cell proliferation
Jian-Ling Gao et al.
The journal of pain : official journal of the American Pain Society, 20(12), 1416-1428 (2019-05-16)
Our preliminary experiment indicated the activation of with-nolysine kinases 1 (WNK1) in bone cancer pain (BCP) rats. This study aimed to investigate the underlying mechanisms via which WNK1 contributed to BCP. A rat model of BCP was induced by Walker-256
Perrine Friedel et al.
Science signaling, 8(383), ra65-ra65 (2015-07-02)
Activation of Cl(-)-permeable γ-aminobutyric acid type A (GABAA) receptors elicits synaptic inhibition in mature neurons but excitation in immature neurons. This developmental "switch" in the GABA function depends on a postnatal decrease in intraneuronal Cl(-) concentration mediated by KCC2, a

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.