Direkt zum Inhalt
Merck

EHU089561

Sigma-Aldrich

MISSION® esiRNA

targeting human ADAM12

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GACCTCTGGATCCCAGTGAAGAGCTTCGACTCCAAGAATCATCCAGAAGTGCTGAATATTCGACTACAACGGGAAAGCAAAGAACTGATCATAAATCTGGAAAGAAATGAAGGTCTCATTGCCAGCAGTTTCACGGAAACCCACTATCTGCAAGACGGTACTGATGTCTCCCTCGCTCGAAATTACACGGTAATTCTGGGTCACTGTTACTACCATGGACATGTACGGGGATATTCTGATTCAGCAGTCAGTCTCAGCACGTGTTCTGGTCTCAGGGGACTTATTGTGTTTGAAAATGAAAGCTATGTCTTAGAACCAATGAAAAGTGCAACCAACAGATACAAACTCTTCCCAGCGAAGAAGCTGAAAAGCGTCCGGGGATCATGTGGATCACATCACAACACACCAAACCTCGCTGCAAAGAATGT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Lingdan Chen et al.
Experimental biology and medicine (Maywood, N.J.), 242(14), 1432-1443 (2017-06-24)
Individuals with diabetes mellitus suffer from impaired angiogenesis and this contributes to poorer peripheral arterial disease outcomes. In experimental peripheral arterial disease, angiogenesis and perfusion recovery are impaired in mice with diabetes. We recently showed that a disintegrin and metalloproteinase
Junwen Wang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 97, 1066-1077 (2017-11-16)
Pituitary adenomas are the second most common primary brain tumor with invasive properties. We have previously identified that ADAM12 (a disintegrin and metalloprotease 12) overexpression is associated with the tumor invasion of pituitary adenomas, however, the underlying mechanism remains unknown.
Sara Duhachek-Muggy et al.
Molecular cancer, 16(1), 32-32 (2017-02-06)
ADAM12 is upregulated in human breast cancers and is a predictor of chemoresistance in estrogen receptor-negative tumors. ADAM12 is induced during epithelial-to-mesenchymal transition, a feature associated with claudin-low breast tumors, which are enriched in cancer stem cell (CSC) markers. It
Yuto Nakamura et al.
American journal of physiology. Heart and circulatory physiology, 318(2), H238-H251 (2019-11-28)
A disintegrin and metalloproteinase (ADAM)12 is considered to promote cardiac dysfunction based on the finding that a small-molecule ADAM12 inhibitor, KB-R7785, ameliorated cardiac function in a transverse aortic constriction (TAC) model by inhibiting the proteolytic activation of heparin-binding-EGF signaling. However
Roopali Roy et al.
Molecular cancer research : MCR, 15(11), 1608-1622 (2017-08-03)
ADAM12, (

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.