Direkt zum Inhalt
Merck

EHU089291

Sigma-Aldrich

MISSION® esiRNA

targeting human NKX3-1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GGTGATCGAGTTGGAGAGGAAGTTCAGCCATCAGAAGTACCTGTCGGCCCCTGAACGGGCCCACCTGGCCAAGAACCTCAAGCTCACGGAGACCCAAGTGAAGATATGGTTCCAGAACAGACGCTATAAGACTAAGCGAAAGCAGCTCTCCTCGGAGCTGGGAGACTTGGAGAAGCACTCCTCTTTGCCGGCCCTGAAAGAGGAGGCCTTCTCCCGGGCCTCCCTGGTCTCCGTGTATAACAGCTATCCTTACTACCCATACCTGTACTGCGTGGGCAGCTGGAGCCCAGCTTTTTGGTAATGCCAGCTCAGGTGACAACCATTATGATCAAAAACTGCCTTCCCCAGGGTGTCTCTATGAAAAGCACAAGGGGCCAAGGTCAGGGAGCAAGAGGTGTGCACACCAAAGCTATTGGAGATTTGCGTGG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Nathan A Damaschke et al.
Cancer research, 77(19), 5236-5247 (2017-08-05)
Loss of imprinting (LOI) is an epigenetic event that relaxes an allele-specific restriction on gene expression. One gene that experiences LOI is the paracrine insulin-like growth factor
Z T Gu et al.
Scientific reports, 5, 11497-11497 (2015-06-25)
In this study, We demonstrated that Bax mitochondrial translocation plays a vital role in the initiation of the mitochondrial signaling pathway upon activation by heat stress. In addition, both p53 mitochondrial translocation and Ca(2+) signal mediated MPTP opening activate Bax
Desheng Zhong et al.
Journal of cellular biochemistry, 115(9), 1624-1635 (2014-05-03)
Pan-Bcl-2 family inhibitor obatoclax has been demonstrated to be effective against various cancers, of which the mechanism of action is not fully understood. In this study, we demonstrate that obatoclax suppressed esophageal cancer cell viability with concomitant G1/G0-phase cell cycle
N Bah et al.
Cell death & disease, 5, e1291-e1291 (2014-06-13)
Antimitotic agents such as microtubule inhibitors (paclitaxel) are widely used in cancer therapy while new agents blocking mitosis onset are currently in development. All these agents impose a prolonged mitotic arrest in cancer cells that relies on sustained activation of
Xue Bai et al.
Oncology reports, 33(6), 3085-3092 (2015-05-13)
Cervical cancer is the second most common women carcinoma worldwide and the fourth leading cause of cancer-associated mortality in women. Butein, a bioactive flavonoid isolated from numerous native plants, has been shown to induce apoptosis and inhibits migration and invasion

Protokolle

Coronavirus qPCR Primer and probe sets for the detection of SARS-CoV-2 (Corona Virus), with additional real-time RT-PCR, RT-qPCR and supporting reagents available.

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.