Direkt zum Inhalt
Merck
Alle Fotos(1)

Wichtige Dokumente

EHU087041

Sigma-Aldrich

MISSION® esiRNA

targeting human BCL2L1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

100

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGTTTGTGGCCTCAGAATTGATCATTTTCCCCCCACTCTCCCCACACTAACCTGGGTTCCCTTTCCTTCCATCCCTACCCCCTAAGAGCCATTTAGGGGCCACTTTTGACTAGGGATTCAGGCTGCTTGGGATAAAGATGCAAGGACCAGGACTCCCTCCTCACCTCTGGACTGGCTAGAGTCCTCACTCCCAGTCCAAATGTCCTCCAGAAGCCTCTGGCTAGAGGCCAGCCCCACCCAGGAGGGAGGGGGCTATAGCTACAGGAAGCACCCCATGCCAAAGCTAGGGTGGCCCTTGCAGTTCAGCACCACCCTAGTCCCTTCCCCTCCCTGGCTCCCATGACCATACTGAGGGACCAACTGGGCCCAAGACAGATGCCCCAGAGCTGTTTATGGCCTCAGCTGCCTCACTTCCTACAAGAGCAGCCTGTG

Ensembl | Human Hinterlegungsnummer

ENSG00000171552

NCBI-Hinterlegungsnummer

NM_001191

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... BCL2L1(598) , BCL2L1(598)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sie haben nicht das passende Produkt gefunden?  

Probieren Sie unser Produkt-Auswahlhilfe. aus.

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Jihong Shi et al.
Laboratory investigation; a journal of technical methods and pathology, 98(11), 1423-1437 (2018-08-10)
Hypertrophic scarring is a serious fibrotic skin disease, and the abnormal activation of hypertrophic scar fibroblasts (HSFs) intensifies its pathogenesis. Our previous studies have demonstrated that the dysregulation of autophagy in HSFs is associated with fibrosis. However, knowledge regarding the
Yun Jung Choi et al.
Scientific reports, 9(1), 7193-7193 (2019-05-12)
Mantle cell lymphoma (MCL) is typically an aggressive and rare form of non-Hodgkin lymphoma (NHL) with a poor prognosis despite recent advances in immunochemotherapy and targeted therapeutics against NHL. New therapeutic agents are needed for MCL. In this study, we
Sahar Taghavi et al.
International journal of pharmaceutics, 516(1-2), 301-312 (2016-11-15)
In this project, synergistic cancer cell death was achieved by a targeted delivery system comprising Bcl-xL-specific shRNA and a very low DOX content, which simultaneously activated an intrinsic apoptotic pathway. A modified branched polyethylenimine (PEI 10kDa) was grafted through polyethylene
Sachie Hirai et al.
Biochemical and biophysical research communications, 526(2), 417-423 (2020-04-01)
Although most EGFR-mutant lung adenocarcinomas initially respond to EGFR inhibitors, disease progression almost inevitably occurs. We previously reported that two EGFR-mutant lung adenocarcinoma cell lines, HCC827 and H1975, contain subpopulations of cells that display an epithelial-to-mesenchymal phenotype and can thrive
Wenshu Chen et al.
Molecular carcinogenesis, 55(11), 1858-1866 (2015-11-27)
The interaction between epithelial and stromal cells through soluble factors such as cytokines plays an important role in carcinogenesis. Breaking this cancer-promoting interaction poses an opportunity for cancer prevention. The tumor-promoting function of interleukin 6 (IL-6) has been documented; however
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.