Direkt zum Inhalt
Merck

EHU084971

Sigma-Aldrich

MISSION® esiRNA

targeting human ILF3

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TGGCATTTATGACCCTTGTGAAAAAGAAGCCACTGATGCTATTGGGCATCTAGACAGACAGCAACGGGAAGATATCACACAGAGTGCGCAGCACGCACTGCGGCTCGCTGCCTTCGGCCAGCTCCATAAAGTCCTAGGCATGGACCCTCTGCCTTCCAAGATGCCCAAGAAACCAAAGAATGAAAACCCAGTGGACTACACCGTTCAGATCCCACCAAGCACCACCTATGCCATTACGCCCATGAAACGCCCAATGGAGGAGGACGGGGAGGAGAAGTCGCCCAGCAAAAAGAAGAAGAAGATTCAGAAGAAAGAGGAGAAGGCAGAGCCCCCCCAGGCTATGAATGCCCTGATGCGGTTGAACCAGCTGAAGCCAGGGCTGCAGTACAAGCTGGTGTCCCA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

M Laura Idda et al.
Nucleic acids research, 46(22), 12040-12051 (2018-10-03)
Polymorphisms in untranslated regions (UTRs) of disease-associated mRNAs can alter protein production. We recently identified a genetic variant in the 3'UTR of the TNFSF13B gene, encoding the cytokine BAFF (B-cell-activating factor), that generates an alternative polyadenylation site yielding a shorter
Tracey W Chan et al.
Genome biology, 21(1), 268-268 (2020-10-28)
RNA editing generates modifications to the RNA sequences, thereby increasing protein diversity and shaping various layers of gene regulation. Recent studies have revealed global shifts in editing levels across many cancer types, as well as a few specific mechanisms implicating
Zejin Pu et al.
Journal of cellular biochemistry, 120(10), 18172-18185 (2019-05-31)
Adenosine is a promising cytotoxic reagent for tumors, long noncoding RNA (lncRNA) maternally expressed gene 3 (MEG3) has been indicated to play critical roles in tumorigenesis, ILF3 has been recognized as a MEG3-binding protein, however, the roles of adenosine and
Rong Jia et al.
RNA (New York, N.Y.), 25(5), 630-644 (2019-02-24)
Alternative RNA splicing is an important focus in molecular and clinical oncology. We report here that SRSF3 regulates alternative RNA splicing of interleukin enhancer binding factor 3 (ILF3) and production of this double-strand RNA-binding protein. An increased coexpression of ILF3

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.