Direkt zum Inhalt
Merck

EHU080371

Sigma-Aldrich

MISSION® esiRNA

targeting human STEAP4

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AGCGCCTCTCCCTCAGTTATGGAGAAAACTTGTATAGATGCACTTCCTCTTACTATGAATTCTTCAGAAAAGCAAGAGACTGTATGTATTTTTGGAACTGGTGATTTTGGAAGATCACTGGGATTGAAAATGCTCCAGTGTGGTTATTCTGTTGTTTTTGGAAGTCGAAACCCCCAGAAGACCACCCTACTGCCCAGTGGTGCAGAAGTCTTGAGCTATTCAGAAGCAGCCAAGAAGTCTGGCATCATAATCATAGCAATCCACAGAGAGCATTATGATTTTCTCACAGAATTAACTGAGGTTCTCAATGGAAAAATATTGGTAGACATCAGCAACAACCTCAAAATCAATCAATATCCAGAATCTAATGCAGAGTACCTTGCTCATTTGGTGCCAGGAGCCCACGTGGTAAAAGCATTTAACACCATCTCAGCCTGGG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Feng Wang et al.
Journal of cellular and molecular medicine, 21(12), 3298-3308 (2017-06-21)
The aim of this study was to investigate whether overexpression of STAMP2 improves insulin resistance by regulating angiogenesis in adipose tissues. The characteristics of diabetic mice were measured by serial metabolite and pathology tests. Samples were obtained from epididymal, subcutaneous
Yoo Jin Oh et al.
Molecular pharmacology, 94(6), 1401-1411 (2018-10-28)
Nonalcoholic fatty liver disease (NAFLD) is an increasingly studied condition that can progress to end-stage liver disease. Although NAFLD was first described in 1980, a complete understanding of the mechanism and causes of this disease is still lacking. Six-transmembrane protein
Hye Young Kim et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 34(9), 12354-12366 (2020-07-29)
Although previous studies have shown that the administration of fibroblast growth factor 21 (FGF21) reverses hepatic steatosis, the mechanism by which FGF21 exerts a therapeutic effect on nonalcoholic fatty liver disease (NAFLD) is not yet entirely understood. We previously demonstrated
Sung Won Lee et al.
Bone research, 6, 20-20 (2018-07-14)
Free fatty acids (FFAs), which are elevated with metabolic syndrome, are considered the principal offender exerting lipotoxicity. Few previous studies have reported a causal relationship between FFAs and osteoarthritis pathogenesis. However, the molecular mechanism by which FFAs exert lipotoxicity and

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.